ID: 1061807736

View in Genome Browser
Species Human (GRCh38)
Location 9:133145762-133145784
Sequence CCTGACCTGCACAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061807722_1061807736 17 Left 1061807722 9:133145722-133145744 CCCAAACTAGCCATTGTGCCTTT 0: 1
1: 0
2: 2
3: 8
4: 163
Right 1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG No data
1061807723_1061807736 16 Left 1061807723 9:133145723-133145745 CCAAACTAGCCATTGTGCCTTTC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG No data
1061807727_1061807736 -1 Left 1061807727 9:133145740-133145762 CCTTTCAGGGCCTCCCCAGTCTC 0: 1
1: 2
2: 6
3: 38
4: 352
Right 1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG No data
1061807726_1061807736 7 Left 1061807726 9:133145732-133145754 CCATTGTGCCTTTCAGGGCCTCC 0: 1
1: 0
2: 2
3: 22
4: 238
Right 1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG No data
1061807720_1061807736 30 Left 1061807720 9:133145709-133145731 CCAGTTCTGTGACCCCAAACTAG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG No data
1061807721_1061807736 18 Left 1061807721 9:133145721-133145743 CCCCAAACTAGCCATTGTGCCTT 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061807736 Original CRISPR CCTGACCTGCACAATGGGGA TGG Intronic
No off target data available for this crispr