ID: 1061808146

View in Genome Browser
Species Human (GRCh38)
Location 9:133147909-133147931
Sequence AGGCCTCCTCACTCCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061808134_1061808146 22 Left 1061808134 9:133147864-133147886 CCCCTCTTTCCCTCTGCTGGTCC 0: 1
1: 0
2: 9
3: 70
4: 633
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data
1061808141_1061808146 12 Left 1061808141 9:133147874-133147896 CCTCTGCTGGTCCTGGGGTGTCC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data
1061808136_1061808146 20 Left 1061808136 9:133147866-133147888 CCTCTTTCCCTCTGCTGGTCCTG 0: 1
1: 0
2: 3
3: 47
4: 565
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data
1061808144_1061808146 -9 Left 1061808144 9:133147895-133147917 CCAGTTCACTCGTGAGGCCTCCT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data
1061808135_1061808146 21 Left 1061808135 9:133147865-133147887 CCCTCTTTCCCTCTGCTGGTCCT 0: 1
1: 0
2: 3
3: 81
4: 586
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data
1061808140_1061808146 13 Left 1061808140 9:133147873-133147895 CCCTCTGCTGGTCCTGGGGTGTC 0: 1
1: 0
2: 1
3: 34
4: 245
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data
1061808142_1061808146 1 Left 1061808142 9:133147885-133147907 CCTGGGGTGTCCAGTTCACTCGT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061808146 Original CRISPR AGGCCTCCTCACTCCAACCA GGG Intronic
No off target data available for this crispr