ID: 1061808609

View in Genome Browser
Species Human (GRCh38)
Location 9:133149661-133149683
Sequence CCGAGTCCAGCAGGTGGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061808609_1061808620 2 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808620 9:133149686-133149708 CGGCGGATGGCTGGGAGCTGGGG No data
1061808609_1061808619 1 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808619 9:133149685-133149707 TCGGCGGATGGCTGGGAGCTGGG No data
1061808609_1061808616 -7 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808616 9:133149677-133149699 GACTCGGCTCGGCGGATGGCTGG No data
1061808609_1061808621 3 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808621 9:133149687-133149709 GGCGGATGGCTGGGAGCTGGGGG No data
1061808609_1061808618 0 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808618 9:133149684-133149706 CTCGGCGGATGGCTGGGAGCTGG No data
1061808609_1061808622 11 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808622 9:133149695-133149717 GCTGGGAGCTGGGGGACCCGAGG No data
1061808609_1061808617 -6 Left 1061808609 9:133149661-133149683 CCGATGCCACCTGCTGGACTCGG No data
Right 1061808617 9:133149678-133149700 ACTCGGCTCGGCGGATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061808609 Original CRISPR CCGAGTCCAGCAGGTGGCAT CGG (reversed) Intergenic
No off target data available for this crispr