ID: 1061811136

View in Genome Browser
Species Human (GRCh38)
Location 9:133163386-133163408
Sequence TTCCCGCGTGTCCTCCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061811136_1061811139 -6 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811139 9:133163403-133163425 CGGGAACGGCTGTAAAACGCTGG No data
1061811136_1061811147 28 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG No data
1061811136_1061811140 -5 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811140 9:133163404-133163426 GGGAACGGCTGTAAAACGCTGGG No data
1061811136_1061811142 6 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811142 9:133163415-133163437 TAAAACGCTGGGCGCAGCCCGGG No data
1061811136_1061811143 19 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811143 9:133163428-133163450 GCAGCCCGGGCCACAGTGAGCGG No data
1061811136_1061811146 27 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811146 9:133163436-133163458 GGCCACAGTGAGCGGAGAGCCGG No data
1061811136_1061811141 5 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811141 9:133163414-133163436 GTAAAACGCTGGGCGCAGCCCGG No data
1061811136_1061811149 29 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811149 9:133163438-133163460 CCACAGTGAGCGGAGAGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061811136 Original CRISPR TTCCCGCGTGTCCTCCCCCC GGG (reversed) Intronic
900477699 1:2883665-2883687 GGCCAGCGTGTCCTGCCCCCTGG + Intergenic
902810383 1:18884878-18884900 TGCCCACGTGTCCTCCTGCCTGG - Intronic
906242202 1:44248925-44248947 CTGCCGTGTGTCCCCCCCCCAGG - Intronic
913674499 1:121128423-121128445 TTCCAGAGTGTCCTCCCACAAGG + Intergenic
914026282 1:143915732-143915754 TTCCAGAGTGTCCTCCCACAAGG + Intergenic
914664719 1:149823485-149823507 TTCCAGAGTGTCCTCCCACAAGG + Intergenic
914671046 1:149870333-149870355 TTCCAGAGTGTCCTCCCACAAGG - Intronic
915526771 1:156480906-156480928 TTCCAGCGAGTCCTCCCCGTCGG + Exonic
920186492 1:204162555-204162577 TTCCTGTCTGTCCTCCCGCCAGG - Intronic
1063593008 10:7410380-7410402 CTCCCGCGTCTCCTCCGCGCTGG - Intronic
1069593675 10:69656880-69656902 TTCCTGGGTGTGGTCCCCCCAGG + Intergenic
1072794056 10:98340722-98340744 TTCCAGTCTGTCCTCCACCCTGG + Intergenic
1073441483 10:103555275-103555297 CTCCCCCGTCTCCTCCCCCGCGG - Intronic
1074618326 10:115092980-115093002 GGCCCGCGTGCCCTTCCCCCCGG - Intergenic
1074693838 10:116030157-116030179 ATCCAGCGGGTCCTCCACCCAGG + Intergenic
1082792869 11:57359317-57359339 TTCCCTGGCTTCCTCCCCCCTGG - Intronic
1084370228 11:68736843-68736865 TTCCCCCTTTTCCTCTCCCCCGG - Intronic
1084500083 11:69530246-69530268 TTCCAGCCTGACCTCCCTCCTGG - Intergenic
1085521981 11:77144445-77144467 CTCCCGCTTCTCCTCCACCCAGG + Intronic
1088823028 11:113472777-113472799 TTCCCTCCTGCCCTCCCCTCTGG - Intronic
1091189723 11:133681092-133681114 TTTCCGCGTTTCCTTCTCCCTGG + Intergenic
1091656740 12:2351633-2351655 TTCCCACTTGTCCTTCCCCAGGG + Intronic
1096489461 12:52006035-52006057 TTCCCGCCTCTCCTACCGCCTGG + Intergenic
1111397108 13:87677838-87677860 TTCCCGCCTCTCCTCCTCCCCGG - Exonic
1113561862 13:111287584-111287606 CTCCCACCTGTCCTCCCCACTGG - Intronic
1113778510 13:112962693-112962715 TTCTCCCGGGACCTCCCCCCAGG + Intronic
1121713969 14:96059716-96059738 GTCCCGCCTTTCCTCCTCCCTGG + Intronic
1122161115 14:99784718-99784740 TTCCCGTGTGTCATCCGGCCTGG - Intronic
1122542418 14:102505762-102505784 TGCCCAGGTGTGCTCCCCCCAGG + Exonic
1123944954 15:25234512-25234534 CACCCACGTGTCCTGCCCCCAGG - Intergenic
1127812152 15:62573652-62573674 TTCCAGAGTCTCCTTCCCCCAGG + Intronic
1135015980 16:18925804-18925826 TTCCTGGGTCTCCTCCGCCCCGG - Intronic
1135321599 16:21501631-21501653 TTCCTGGGTCTCCTCCGCCCCGG - Intergenic
1135437351 16:22437588-22437610 TTCCTGGGTCTCCTCCGCCCCGG + Intergenic
1136447772 16:30334829-30334851 TTCCTGGGTCTCCTCCTCCCCGG - Intergenic
1136625354 16:31458882-31458904 GTCCCGAGTGTCCTCCGCTCTGG - Intronic
1141609537 16:85173480-85173502 GACCCTCGTGTCCTCCACCCTGG + Intronic
1141996510 16:87639601-87639623 CTCCCTCCTGTCCTCCCTCCTGG + Intronic
1141996532 16:87639661-87639683 CTCCCTCCTGTCCTCCCTCCTGG + Intronic
1142623218 17:1178059-1178081 TTCCTTCCTCTCCTCCCCCCAGG - Intronic
1143161467 17:4874526-4874548 ATCCCTCATGTCCTCCCTCCTGG - Intronic
1147254555 17:39174290-39174312 ATCCCACGGGTCCTCTCCCCTGG + Exonic
1147263533 17:39222380-39222402 TTCTCGCTTCTCCACCCCCCTGG - Intronic
1147341279 17:39754497-39754519 CTCCCCCGTTTCCTCCCCGCAGG + Intergenic
1151250244 17:72828690-72828712 TTGCAGCGTGTCCACCTCCCCGG - Intronic
1152749148 17:82054575-82054597 CTTCCGCGTGGCCTCCACCCAGG - Exonic
1152823307 17:82448281-82448303 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823323 17:82448362-82448384 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823339 17:82448443-82448465 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823355 17:82448524-82448546 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823371 17:82448605-82448627 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823387 17:82448686-82448708 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823403 17:82448767-82448789 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1152823419 17:82448848-82448870 TTCCCATGTCTCCTCCTCCCTGG - Intronic
1160297585 18:77651724-77651746 TTCCTGCGTGTCCTCACCCAAGG - Intergenic
1160851540 19:1195255-1195277 TGCCCGCCAGTCCTCCCTCCTGG - Intronic
1160851964 19:1197069-1197091 TGCCCGCCAGTCCTCCCTCCTGG - Intronic
1160895876 19:1401568-1401590 CTCTCGCGGGTCCGCCCCCCGGG - Exonic
1160941141 19:1620977-1620999 TACCCCCGTGGGCTCCCCCCAGG - Exonic
1160947755 19:1651661-1651683 TTCCCGGGCCGCCTCCCCCCGGG - Intronic
1162412574 19:10515319-10515341 TCCCCGCCTGTAATCCCCCCAGG + Intronic
1162572097 19:11479891-11479913 CTCCCGGGTCTCCGCCCCCCGGG - Intronic
1165114829 19:33522434-33522456 TTCTCGCCTGCCCTCCTCCCTGG - Intergenic
1166996288 19:46721157-46721179 TTCCCGCCTGTCCTTCTGCCTGG - Intronic
1167056230 19:47112858-47112880 CTCCCGGGTGTCCCGCCCCCCGG - Intronic
1167713820 19:51128075-51128097 TTCCAGCCTGTCCTCCCCCAGGG - Intronic
1168420515 19:56199377-56199399 TTCCCCCGAATCCTCCCCTCTGG + Intergenic
926164373 2:10510484-10510506 TTCCCCCCTGCCCACCCCCCTGG + Intergenic
932779151 2:74549246-74549268 TTCCCGCGCGTCCCGACCCCCGG + Intronic
935750761 2:106232034-106232056 TTCCTGTGTGTCCTCCCTGCTGG + Intergenic
936937144 2:117849334-117849356 TTCCCTCGTTTTCTCCGCCCAGG - Intergenic
939966537 2:148615805-148615827 TTTCTGAGTGTCCTCACCCCAGG - Intergenic
947748575 2:232521757-232521779 CTCTCGCCTGTCCTCACCCCAGG - Intronic
948482911 2:238261696-238261718 TGCCTGCATGTCCTCCTCCCAGG - Intronic
1170607721 20:17886400-17886422 TTCCAGCCTGTCCTCCCCAATGG + Intergenic
1172174931 20:32966526-32966548 TTCCCCCGTGTCCTTCCTCTGGG - Intergenic
1172876125 20:38165317-38165339 TTCCCGCGGGGCCCCGCCCCCGG - Exonic
1173656424 20:44703188-44703210 GTCCCACGTGCCCTCCACCCTGG + Intergenic
1175765119 20:61587156-61587178 TTCCTCCTTGTCCTCCCCACTGG - Intronic
1175770384 20:61619769-61619791 TTCCTGAGTGCCCTCCCACCCGG - Intronic
1175851748 20:62097516-62097538 TTCCCGCCTGTCCTCACACTGGG + Intergenic
1176017672 20:62944361-62944383 TTCCCCCGGGTCCTCTCCCGGGG + Intronic
1176299983 21:5094952-5094974 TCCCTGCCTGTCCTGCCCCCGGG + Intergenic
1176738690 21:10576466-10576488 TTCAGGTGTATCCTCCCCCCAGG - Intronic
1177515116 21:22139304-22139326 TTCCCGCCAGTACTCCCCTCAGG - Intergenic
1179857039 21:44166959-44166981 TCCCTGCCTGTCCTGCCCCCGGG - Intergenic
1180769570 22:18371451-18371473 TTCCCTCGTGTCTTCTACCCAGG + Intergenic
1180776758 22:18491215-18491237 TTCCCTCGTGTCTTCTACCCAGG - Intergenic
1180809486 22:18748581-18748603 TTCCCTCGTGTCTTCTACCCAGG - Intergenic
1184729305 22:46364251-46364273 TTGCCGTGTCTCCTCCTCCCAGG - Exonic
1185048397 22:48540509-48540531 TTCTAGGGTGTCCTCCGCCCCGG + Intronic
1203277606 22_KI270734v1_random:100404-100426 TTCCCTCGTGTCTTCTACCCAGG + Intergenic
961780826 3:129319205-129319227 ATCCTCCGTGTCCTCCCCCCGGG - Intergenic
968816208 4:2823208-2823230 TCTCCGCGTGTCCTGCCCTCAGG + Intronic
968977898 4:3831321-3831343 TGCCCACTTGTCCTCCCCCAGGG - Intergenic
969090156 4:4688056-4688078 TTCCTGCGTTCCCTCCTCCCTGG + Intergenic
969344350 4:6562024-6562046 GTCCCAGGTGTCCTCACCCCTGG - Intronic
984811089 4:183797347-183797369 CTCCCGCGTCTCCGCCCCCGCGG + Intergenic
985723184 5:1501410-1501432 TGGCCGCGTGACCCCCCCCCAGG + Intronic
994630211 5:102276017-102276039 TTTCCTGGTGTCCTCCCCACTGG - Intronic
999084830 5:148878295-148878317 TTCCCCCATCTCCTCCCCCTGGG - Intergenic
999144586 5:149383802-149383824 TGCCAGCGTCTCCTCCCCACAGG + Intronic
1001563776 5:172686715-172686737 GTCCCCCGTGTTCTCCCCACCGG + Exonic
1003425747 6:5997225-5997247 TTCCCCCGTCCCCCCCCCCCGGG + Intergenic
1006835739 6:36997831-36997853 TTCCCGCCCCTCCTCCCACCAGG - Intergenic
1006860701 6:37170113-37170135 TCCCCGCGCGCCCTCCCCGCCGG + Intergenic
1007105877 6:39282530-39282552 TTCCCGTCTGTTCTCTCCCCAGG - Intergenic
1011765015 6:90611058-90611080 GCCCCGCGCGTCCTCTCCCCCGG - Intergenic
1018070660 6:160161634-160161656 TTCCAGGGTCTCCTCCACCCTGG + Intergenic
1019716770 7:2542787-2542809 TTCCCACCTGTCCTGACCCCAGG + Intronic
1022152168 7:27618952-27618974 TGCCCCCGTGACCTCCCACCAGG + Intronic
1026772231 7:73209814-73209836 TTCCCGCAGGACCTCCCTCCAGG - Intergenic
1027013100 7:74763207-74763229 TTCCCGCAGGACCTCCCTCCAGG - Intergenic
1027074941 7:75182827-75182849 TTCCCGCAGGACCTCCCTCCAGG + Intergenic
1029460529 7:100691688-100691710 TTCCAGCCTGTCCCCCGCCCTGG + Intergenic
1032017052 7:128387105-128387127 TTCCTGCATCTCCTCTCCCCAGG + Intergenic
1032090698 7:128910229-128910251 TTCCCGCCTGTCCTGCTCCGGGG + Intronic
1037883683 8:22585408-22585430 CTCCAGCCTGTCCTCCCCCAGGG - Intronic
1048442245 8:134468728-134468750 TTCCCGCTGGTCCTCCTGCCTGG - Intergenic
1061280806 9:129596963-129596985 TTCCCGGGTGCCCTCCTCCCCGG - Intergenic
1061811136 9:133163386-133163408 TTCCCGCGTGTCCTCCCCCCGGG - Intronic
1061999231 9:134207603-134207625 TCCCCACCTGTCCTCCCCACCGG + Intergenic
1061999296 9:134207792-134207814 TCCCCACCTGTCCTCCCCACCGG + Intergenic
1061999344 9:134207936-134207958 TCCCCACCTGTCCTCCCCACTGG + Intergenic
1062014355 9:134283802-134283824 TTCCCGGGTGTCCTGCCTCCTGG - Intergenic
1062039882 9:134399578-134399600 GTCCTGCCTGTCCTCCTCCCAGG + Intronic
1203788054 EBV:138857-138879 CTCACACGTGCCCTCCCCCCGGG + Intergenic
1189292282 X:39894855-39894877 TTCCTGCTTCCCCTCCCCCCAGG - Intergenic
1198416505 X:136425599-136425621 TTCCTCCGTGTACTCCCCCTTGG - Intergenic
1199747684 X:150784259-150784281 TCCCCGCTTCTCCTCCCCTCCGG + Intronic