ID: 1061811137

View in Genome Browser
Species Human (GRCh38)
Location 9:133163387-133163409
Sequence GTTCCCGCGTGTCCTCCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061811137_1061811141 4 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811141 9:133163414-133163436 GTAAAACGCTGGGCGCAGCCCGG No data
1061811137_1061811140 -6 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811140 9:133163404-133163426 GGGAACGGCTGTAAAACGCTGGG No data
1061811137_1061811146 26 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811146 9:133163436-133163458 GGCCACAGTGAGCGGAGAGCCGG No data
1061811137_1061811143 18 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811143 9:133163428-133163450 GCAGCCCGGGCCACAGTGAGCGG No data
1061811137_1061811149 28 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811149 9:133163438-133163460 CCACAGTGAGCGGAGAGCCGGGG No data
1061811137_1061811147 27 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG No data
1061811137_1061811142 5 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811142 9:133163415-133163437 TAAAACGCTGGGCGCAGCCCGGG No data
1061811137_1061811139 -7 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811139 9:133163403-133163425 CGGGAACGGCTGTAAAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061811137 Original CRISPR GTTCCCGCGTGTCCTCCCCC CGG (reversed) Intronic
900378623 1:2372912-2372934 GTTCCCGCACGTCTTCCCGCTGG + Intronic
900412999 1:2521512-2521534 GCGCCCGCCTGTGCTCCCCCGGG - Intronic
901269760 1:7942619-7942641 GCGCCCGCGTTTCCTCCCGCGGG + Intronic
902640762 1:17764782-17764804 GTTTCTGCGTGAACTCCCCCGGG - Intronic
904746333 1:32713458-32713480 CTTTCCCCGTGTCCTCTCCCAGG + Intergenic
905626138 1:39491612-39491634 ATTCCCGCGAGTCCTTGCCCCGG - Intergenic
909511989 1:76463853-76463875 GTTCCTGCTAGTGCTCCCCCTGG - Intronic
910292869 1:85616195-85616217 GGTCGCGCCTGTCCTCCCGCGGG - Intergenic
913685898 1:121231782-121231804 TTTCCTGCATGTGCTCCCCCTGG + Intronic
914950804 1:152111758-152111780 GTTCGCGCCTCTCCTCCTCCTGG + Exonic
915471237 1:156126879-156126901 CTTCGCCCGTGTCCTGCCCCAGG - Intronic
917442152 1:175077640-175077662 GTTCCTCCCTGGCCTCCCCCAGG - Exonic
922727024 1:227927364-227927386 GGTCCCTCCTGTCCTCCCCATGG - Intronic
1065367742 10:24952285-24952307 GTCCCCCCGTGTCCTCCGGCCGG - Intronic
1067068998 10:43119088-43119110 GTTCCCACCTGTCCTGTCCCAGG - Intronic
1070987446 10:80700864-80700886 GTTCCTGCCTGTCCTTCCCTTGG - Intergenic
1073109094 10:101050291-101050313 ACTCCCGCCTTTCCTCCCCCGGG + Intergenic
1077158836 11:1103513-1103535 GTGCCCCCATGTCCTGCCCCAGG + Intergenic
1077333462 11:1993422-1993444 ATTCCCATGTGTCCTTCCCCAGG + Intergenic
1077407379 11:2388721-2388743 GTGCCCTCGTGGCCCCCCCCGGG + Intronic
1080135619 11:28850815-28850837 CCTCCCACGTCTCCTCCCCCAGG - Intergenic
1085314554 11:75536526-75536548 GCTCCCGTGTCTCCTCCTCCAGG + Intergenic
1202816440 11_KI270721v1_random:48604-48626 ATTCCCATGTGTCCTTCCCCAGG + Intergenic
1091656739 12:2351632-2351654 TTTCCCACTTGTCCTTCCCCAGG + Intronic
1097185234 12:57193104-57193126 GTGCCCACGCCTCCTCCCCCGGG - Intronic
1103400700 12:120641084-120641106 GAGCCAGCGTGTGCTCCCCCAGG + Exonic
1104448893 12:128853692-128853714 GGTCCCGCGTCCCCGCCCCCCGG - Intronic
1109275501 13:60299308-60299330 GTTCCTGTGTATCCTCCACCTGG + Intergenic
1110822227 13:79929482-79929504 GTTCCTGTATGTCCTTCCCCTGG - Intergenic
1112966732 13:105205924-105205946 TTTCCCCTGTGTCCTACCCCTGG + Intergenic
1113656614 13:112072115-112072137 GCTCCCGCGTTTCATTCCCCCGG + Intergenic
1113711331 13:112467271-112467293 CTTCCCGCACCTCCTCCCCCAGG + Intergenic
1113888085 13:113671477-113671499 GTTCCCACGTGTCTTCCCCCAGG + Exonic
1118763619 14:68895547-68895569 AGACCCGCGTGTCCTCCTCCAGG + Intronic
1121311671 14:92938736-92938758 GTTCCAGGGTGGCCTCCCCTTGG + Exonic
1122163321 14:99802388-99802410 CTTCCCACCTGCCCTCCCCCTGG - Intronic
1123411579 15:20065621-20065643 GTTCCCAGGTGTCCTGTCCCAGG + Intergenic
1123520928 15:21072740-21072762 GTTCCCAGGTGTCCTGTCCCAGG + Intergenic
1126669645 15:51104529-51104551 GCTCCTGCGTGTCTTTCCCCTGG + Intronic
1128208004 15:65869861-65869883 CTCCCTGCGTGTCCTTCCCCTGG + Intronic
1129995230 15:79998767-79998789 GTTCCCTCAAGTCCTCTCCCAGG - Intergenic
1130516827 15:84632175-84632197 GTTCCCGACTGTCCTTCTCCAGG + Intergenic
1132105461 15:99059474-99059496 GTGCCCGCGGGCCCTCGCCCCGG + Intergenic
1132202896 15:99967364-99967386 GTTTCCACTTGTCCTCCCCGAGG + Intergenic
1132710558 16:1265282-1265304 GTGCCCGCATGTCCTCCAGCTGG + Intergenic
1136570646 16:31094556-31094578 GTTCGCGCGTCTTCTCCTCCAGG - Exonic
1141991759 16:87614778-87614800 GGAGCCGCGTGTCCTCTCCCAGG + Intronic
1142474565 17:181341-181363 CTTCCCGCGGGGCCTGCCCCCGG - Exonic
1142712938 17:1733176-1733198 GTTTCAGCGTGTCATCTCCCTGG + Intronic
1146182191 17:30705647-30705669 GTTCCCGGGTGCCCTGCCTCAGG - Intergenic
1147311812 17:39599993-39600015 GTTCCCTCTTCTCCTCCCCTCGG + Intergenic
1147987892 17:44316682-44316704 CGTCCCGCGTGCCCTCTCCCAGG - Exonic
1149561085 17:57608437-57608459 GTTCCTGCGTTTCCCTCCCCGGG + Intronic
1152580218 17:81162498-81162520 GTCCCCGGGAGTCCTCCCCTTGG - Intronic
1157274482 18:46301275-46301297 GCTCCCTTGTGCCCTCCCCCTGG - Intergenic
1158676444 18:59523792-59523814 GATCCTGCATCTCCTCCCCCTGG + Intronic
1160779357 19:870975-870997 CTTCCTCCGTGTCCTGCCCCGGG - Intronic
1162572098 19:11479892-11479914 GCTCCCGGGTCTCCGCCCCCCGG - Intronic
1162976641 19:14210155-14210177 GTTCCCGGGTGCCCTGCCTCAGG + Intergenic
1167530267 19:50011609-50011631 GGTCCTGCCTGTCTTCCCCCAGG + Intronic
1167530283 19:50011685-50011707 GGTCCTGCCTGTCTTCCCCCAGG + Intronic
1167530300 19:50011761-50011783 GGTCCTGCCTGTCTTCCCCCAGG + Intronic
1167530317 19:50011837-50011859 GGTCCTGCCTGTCTTCCCCCAGG + Intronic
1167713821 19:51128076-51128098 CTTCCAGCCTGTCCTCCCCCAGG - Intronic
929889102 2:45904896-45904918 GTTCCCCTGACTCCTCCCCCAGG - Intronic
934774234 2:96927120-96927142 GTTCCAGCATCTCCTCCCCAAGG - Intronic
942080500 2:172395664-172395686 GTTCCCACATGTCCTCGGCCAGG + Intergenic
946182505 2:217957111-217957133 GTTCCCACGAGGCCACCCCCAGG + Intronic
947623233 2:231604233-231604255 GGCCTCGCGTCTCCTCCCCCAGG + Intergenic
948164808 2:235852747-235852769 GTGCCCGTCAGTCCTCCCCCTGG + Intronic
1169192384 20:3666542-3666564 CTTCCCACGTGGCCTCCCCAGGG + Intergenic
1169432081 20:5545545-5545567 GTGCCCGTGTGTCCTCTGCCTGG - Exonic
1172123283 20:32610923-32610945 GTGCCACTGTGTCCTCCCCCAGG + Intergenic
1172174932 20:32966527-32966549 CTTCCCCCGTGTCCTTCCTCTGG - Intergenic
1175851747 20:62097515-62097537 GTTCCCGCCTGTCCTCACACTGG + Intergenic
1176017671 20:62944360-62944382 CTTCCCCCGGGTCCTCTCCCGGG + Intronic
1176299982 21:5094951-5094973 GTCCCTGCCTGTCCTGCCCCCGG + Intergenic
1179857040 21:44166960-44166982 GTCCCTGCCTGTCCTGCCCCCGG - Intergenic
1180175069 21:46083317-46083339 GCTGCCGCCTGCCCTCCCCCAGG - Intergenic
1180949179 22:19713609-19713631 ATTCCCAGGTGTCCTCCGCCTGG - Intergenic
1182103668 22:27674130-27674152 GTCCCCGGGGGGCCTCCCCCGGG - Intergenic
1184152961 22:42649198-42649220 GGTCCCGCGTCACCTCCCGCAGG + Intronic
952942157 3:38453714-38453736 GTGCACGCGCGTCCTCCCACAGG + Intergenic
961402108 3:126654859-126654881 GTGCCCGCCTGTCGTCCCCCGGG - Intronic
961697086 3:128712827-128712849 GTTACCGCCTGTCCTTCCTCAGG + Intergenic
961780827 3:129319206-129319228 CATCCTCCGTGTCCTCCCCCCGG - Intergenic
965596979 3:170419645-170419667 GCTCCCGCCCGGCCTCCCCCGGG + Intronic
968977899 4:3831322-3831344 CTGCCCACTTGTCCTCCCCCAGG - Intergenic
984073232 4:175143184-175143206 TTTCCCCTGTGTTCTCCCCCAGG + Intergenic
988521023 5:31945749-31945771 CTTCCTGGGTCTCCTCCCCCAGG + Intronic
999084831 5:148878296-148878318 TTTCCCCCATCTCCTCCCCCTGG - Intergenic
999248527 5:150167909-150167931 GCTCCCGCTTCCCCTCCCCCGGG - Intronic
1019525551 7:1478914-1478936 GTCCCCGTGTGTCCTCTGCCAGG - Intronic
1022383717 7:29883874-29883896 GCTCCCGCGCGCCCTCTCCCAGG + Exonic
1032090697 7:128910228-128910250 ATTCCCGCCTGTCCTGCTCCGGG + Intronic
1032516109 7:132507547-132507569 GGTCCAGCGTGCCCTCGCCCCGG + Exonic
1037883684 8:22585409-22585431 CCTCCAGCCTGTCCTCCCCCAGG - Intronic
1037985393 8:23288027-23288049 GTTCCTGCGTTACCTCCCCCAGG + Exonic
1038304162 8:26383630-26383652 GCTCCCGCGCGTCCATCCCCCGG - Intronic
1038421536 8:27437045-27437067 GTTCCCTCCTGGCCTCCCCATGG - Intronic
1041023589 8:53661367-53661389 CTCCCTGCCTGTCCTCCCCCAGG - Intergenic
1046644421 8:116769279-116769301 GTTCCTGCCTTTCCTCTCCCAGG - Intronic
1047606666 8:126481570-126481592 CTTCCCACGTCTCCTCTCCCGGG + Intergenic
1049655341 8:143794657-143794679 GCTCCAGCCTGTCCTCCCCTTGG + Intronic
1049824541 8:144660142-144660164 GCTCCCGTGTCTCCTCCTCCTGG + Intergenic
1053395402 9:37769360-37769382 GTTCCAGCATTTCCTTCCCCAGG + Intronic
1060316364 9:122515095-122515117 GTCCCCTTGTGTCCTCTCCCTGG + Intergenic
1060552496 9:124492300-124492322 GTGCCCCCGTGTCCCCACCCTGG + Intronic
1061207437 9:129173169-129173191 GCTCCCCCTTGTCATCCCCCGGG + Intergenic
1061811137 9:133163387-133163409 GTTCCCGCGTGTCCTCCCCCCGG - Intronic
1062049681 9:134440840-134440862 GTTCCCACCTGTCCCTCCCCAGG + Intergenic
1062365013 9:136204316-136204338 GCACCCGCGTGTCCTTGCCCTGG - Intronic
1186515797 X:10165368-10165390 GTTCCCATGTGTCGTCCCCAGGG - Intronic
1186892657 X:13974825-13974847 GTTCCCGCCAGTCTTCCCCTAGG + Intergenic
1200094200 X:153649708-153649730 CTTCCCTCCTGTCCTCCCCAAGG + Intronic