ID: 1061811147

View in Genome Browser
Species Human (GRCh38)
Location 9:133163437-133163459
Sequence GCCACAGTGAGCGGAGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061811136_1061811147 28 Left 1061811136 9:133163386-133163408 CCCGGGGGGAGGACACGCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG No data
1061811137_1061811147 27 Left 1061811137 9:133163387-133163409 CCGGGGGGAGGACACGCGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061811147 Original CRISPR GCCACAGTGAGCGGAGAGCC GGG Intronic
No off target data available for this crispr