ID: 1061813619

View in Genome Browser
Species Human (GRCh38)
Location 9:133179383-133179405
Sequence CTGTTACAAGGGCTGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061813611_1061813619 17 Left 1061813611 9:133179343-133179365 CCAGCCTTGTCCATTTGGTTTTT No data
Right 1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG No data
1061813612_1061813619 13 Left 1061813612 9:133179347-133179369 CCTTGTCCATTTGGTTTTTTAAC No data
Right 1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG No data
1061813614_1061813619 7 Left 1061813614 9:133179353-133179375 CCATTTGGTTTTTTAACTGGTAG No data
Right 1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061813619 Original CRISPR CTGTTACAAGGGCTGGTGCA CGG Intergenic
No off target data available for this crispr