ID: 1061813974

View in Genome Browser
Species Human (GRCh38)
Location 9:133182177-133182199
Sequence CTGGGGGCCTGGTGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061813961_1061813974 19 Left 1061813961 9:133182135-133182157 CCAGCCTTGGAGTAGGGGCTGCT No data
Right 1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG No data
1061813962_1061813974 15 Left 1061813962 9:133182139-133182161 CCTTGGAGTAGGGGCTGCTGCTG No data
Right 1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG No data
1061813969_1061813974 -10 Left 1061813969 9:133182164-133182186 CCCAGGCTCCATGCTGGGGGCCT No data
Right 1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061813974 Original CRISPR CTGGGGGCCTGGTGGCCAGA TGG Intergenic
No off target data available for this crispr