ID: 1061814688

View in Genome Browser
Species Human (GRCh38)
Location 9:133187662-133187684
Sequence TCAGCTCCAGAGGTAGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061814688_1061814694 25 Left 1061814688 9:133187662-133187684 CCGGGCTCTACCTCTGGAGCTGA No data
Right 1061814694 9:133187710-133187732 TCTTCCTCTGAACTTGGCACTGG No data
1061814688_1061814695 26 Left 1061814688 9:133187662-133187684 CCGGGCTCTACCTCTGGAGCTGA No data
Right 1061814695 9:133187711-133187733 CTTCCTCTGAACTTGGCACTGGG No data
1061814688_1061814693 19 Left 1061814688 9:133187662-133187684 CCGGGCTCTACCTCTGGAGCTGA No data
Right 1061814693 9:133187704-133187726 ACTGGCTCTTCCTCTGAACTTGG No data
1061814688_1061814690 1 Left 1061814688 9:133187662-133187684 CCGGGCTCTACCTCTGGAGCTGA No data
Right 1061814690 9:133187686-133187708 GCGAGAGCCAGTGCTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061814688 Original CRISPR TCAGCTCCAGAGGTAGAGCC CGG (reversed) Intergenic
No off target data available for this crispr