ID: 1061817635

View in Genome Browser
Species Human (GRCh38)
Location 9:133206269-133206291
Sequence CAGACACAGCAGAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 535}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061817635 Original CRISPR CAGACACAGCAGAGGGACAC AGG Intronic
900822797 1:4902116-4902138 TGCACACAGCAGAGGGACGCTGG + Intergenic
900907786 1:5572910-5572932 CAGACACTGCAGAGAGAGCCAGG - Intergenic
901082400 1:6591092-6591114 AACCCACAGCAGAGGGAAACTGG + Exonic
901680715 1:10911233-10911255 CACTCAGAGCAGAGGAACACAGG + Intergenic
901770680 1:11529004-11529026 CAGACACATCAGTGGGCCAGGGG + Intronic
902558308 1:17260185-17260207 CAGGGACAGGGGAGGGACACCGG + Intronic
902798840 1:18817080-18817102 CAGAGACAGAAGAGAGACAGAGG + Intergenic
903912429 1:26737510-26737532 CAGACACAGTAGAGAACCACTGG - Intronic
903993145 1:27288491-27288513 CAAACACTGCAGAGGGCCGCAGG - Intronic
904659876 1:32076492-32076514 CAGACACAGTATAGGGACAGGGG + Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
906655104 1:47542539-47542561 TGCACACAGCAGAGGGACCCTGG - Intergenic
908068644 1:60434398-60434420 TGCACACAGCAGAGGGACTCTGG + Intergenic
908442667 1:64170442-64170464 TGCACACAGCAGAGGGACCCTGG + Intronic
908497134 1:64705792-64705814 CAGCCACACCAAGGGGACACAGG + Intergenic
909532944 1:76700921-76700943 CATACACAGCACAGAGGCACGGG - Intergenic
910512933 1:88026017-88026039 TGCACACAGCAGAGGGACCCTGG + Intergenic
910642746 1:89481091-89481113 TGCACACAGCAGAGGGACCCTGG + Intergenic
910731813 1:90406033-90406055 AACACACAGCAGAGGTACACTGG + Intergenic
911309455 1:96275510-96275532 TGTACACAGCAGAGGGACCCTGG - Intergenic
911407823 1:97464511-97464533 TGCACACAGCAGAGGGACCCTGG - Intronic
912135512 1:106656245-106656267 TACACACAGCATGGGGACACTGG + Intergenic
912658794 1:111510305-111510327 CATACAAAGCAGAGGGACTAAGG - Intronic
912692486 1:111814870-111814892 CAGACACATCCTAGGGACTCTGG - Intronic
912960109 1:114188563-114188585 CAGACACAGCAGGGGCAGGCTGG + Intergenic
913242029 1:116837782-116837804 CACACACAGCAGGAGGACCCTGG - Intergenic
915443621 1:155962073-155962095 CAGGCCCAGGAGAGGGCCACTGG - Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915648436 1:157290376-157290398 GAGACACAGGGGAGGGACCCTGG - Intergenic
915890392 1:159768080-159768102 CAAACACTGCAGAAGGCCACAGG + Intergenic
915982356 1:160428251-160428273 CAGACACCACAGAGGAACAGGGG - Exonic
916467179 1:165084228-165084250 TGCACACAGCATAGGGACACTGG - Intergenic
916700117 1:167283664-167283686 CAAACACAACAGAAAGACACAGG - Intronic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
917894948 1:179478536-179478558 AGGGCACAGCAGAGGGACCCTGG + Intronic
918216306 1:182394422-182394444 CAGACACAGCAAAGTCAAACTGG - Intergenic
918591947 1:186249878-186249900 TGCACACAGCAGAGGGACTCTGG + Intergenic
918849788 1:189672145-189672167 CTGACACATCAAAGAGACACAGG - Intergenic
919424031 1:197406429-197406451 CAGACACTGCGGAGGGCCGCAGG + Intronic
920203737 1:204276569-204276591 CACACAGAGCAGAAGGAGACTGG - Intronic
920742846 1:208597896-208597918 CAGAAACAGGAGAGGTATACTGG - Intergenic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
920937487 1:210449159-210449181 CAGACATGGCAGAGGGACCCGGG - Intronic
921326169 1:213987919-213987941 AAGACACAGCTGAAGGAAACAGG - Intronic
921610367 1:217206428-217206450 TGAACACAGCAGAGGGACCCTGG - Intergenic
921902515 1:220465824-220465846 CAAACACTGCAGAGGGCCGCAGG - Intergenic
921996615 1:221426168-221426190 TGCACACAGCAGAGGGACCCTGG + Intergenic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923332451 1:232937879-232937901 CAGCCAGAGCAGAGAGACAAAGG - Intergenic
923469278 1:234276449-234276471 TATACACAGTAGAGGGATACTGG - Intronic
924229211 1:241949284-241949306 CAAAGACAACACAGGGACACAGG - Intergenic
924429275 1:243982938-243982960 CAGATACAACGGAGGGAAACGGG + Intergenic
924719984 1:246613702-246613724 TAGACTCAGAAGAGGGAGACGGG - Intronic
1063073842 10:2694902-2694924 CAGAAACAGGACAGGGAAACAGG + Intergenic
1063531270 10:6833335-6833357 CAAACACTGCAGAAGGCCACAGG - Intergenic
1067077501 10:43196575-43196597 CAGACACTGCATGGGGACACAGG - Intronic
1068683043 10:59840597-59840619 CAGACAAGGCAGTGGGACAGAGG - Intronic
1069708703 10:70475528-70475550 CTGCCACAGCTGAGGGACACTGG - Intergenic
1069951988 10:72025335-72025357 CAGACAAAGCAGAGTGACTGTGG + Intergenic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1073051548 10:100670553-100670575 GAGACACAGGACAGGGACAGAGG - Intergenic
1073817595 10:107224516-107224538 TGCACACAGCAGAGGGACCCTGG + Intergenic
1073883310 10:108008056-108008078 TGCACACAGCACAGGGACACTGG + Intergenic
1073993974 10:109294899-109294921 TACACACAGCACAGGGACCCTGG - Intergenic
1074014292 10:109518029-109518051 GTGAGACAGCAGAGGGAAACGGG + Intergenic
1074242099 10:111649945-111649967 TGTACACAGCAGAGGGACCCTGG - Intergenic
1074640213 10:115370928-115370950 TGGACACAGCAGAGGGACCCTGG - Intronic
1075198125 10:120378771-120378793 CAGCCACAGGAAAGGAACACGGG - Intergenic
1075475476 10:122730140-122730162 CAGAGACAGCAGAGCGTCAATGG + Intergenic
1075550319 10:123388108-123388130 TGCACACAGCAGAGGGACCCTGG - Intergenic
1075826182 10:125358637-125358659 TGCACACAGCAGAGGGACCCTGG + Intergenic
1076333726 10:129691233-129691255 CAGACACAGCTGTGCCACACTGG - Intronic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076689717 10:132216664-132216686 TGCACACAGCAGAGGGACCCTGG - Intronic
1077186013 11:1235709-1235731 CAGACACAGCGGGAGGCCACAGG - Intronic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1078366080 11:10707631-10707653 CAGAAACAGCATGGGAACACAGG + Intergenic
1079020913 11:16908117-16908139 CAAACACTGCAGAGGGCCGCAGG + Intronic
1079181980 11:18201716-18201738 TACACACAGCACAGGGACCCTGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080508078 11:32937760-32937782 TTGTCACAGCAGAGGGACAGTGG - Intronic
1080556052 11:33418461-33418483 CAGACACAGCAGAGCCCCAAAGG - Intergenic
1080817406 11:35771996-35772018 TGCACACAGCACAGGGACACTGG - Intronic
1080973352 11:37304296-37304318 TGAACACAGCAGAGGGACCCTGG + Intergenic
1081224340 11:40501660-40501682 TGCACACAGCAGAGGGACCCTGG + Intronic
1081314232 11:41612051-41612073 CAGTCACATCAGAGGTCCACTGG - Intergenic
1081437320 11:43041147-43041169 TAGAAACAGCACAGGGACCCTGG + Intergenic
1081567946 11:44271113-44271135 CAAACACAGCAGAGGCAGGCAGG + Intronic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1083638120 11:64131165-64131187 CAGGCACTGCAGAGGGAAATGGG + Intronic
1084166323 11:67376333-67376355 CAGGCATGGCAGAGGGGCACTGG - Intronic
1084338236 11:68475056-68475078 CAAACACTGCAGAGGGCCGCAGG - Intronic
1084342500 11:68515368-68515390 CAGACACAGCACAGTACCACAGG + Intronic
1084356792 11:68644226-68644248 CAGACACAGCACAGTACCACAGG + Intergenic
1084768229 11:71326071-71326093 CAGCCACAGCAAAGGAATACAGG + Intergenic
1084970371 11:72768242-72768264 CAGAAAGAGCAGAGGGGCACTGG - Intronic
1085514628 11:77105152-77105174 CGGGCACAGCAGAGGGACTCAGG - Intronic
1085529773 11:77184381-77184403 CCCACACAGCAGGGGCACACTGG - Intronic
1086287943 11:85271115-85271137 TGCACACAGCAGAGGGACCCTGG - Intronic
1087299852 11:96419603-96419625 CATACATAGCAGAAGGAAACTGG + Intronic
1087496317 11:98894416-98894438 CACACACAGCACAGGGACCCTGG + Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088277340 11:108101740-108101762 AAAAGAGAGCAGAGGGACACTGG - Intronic
1088871572 11:113894589-113894611 CAGAGACAGCACAGACACACGGG - Intergenic
1089732966 11:120530881-120530903 CAGAGACATCAGTAGGACACAGG - Intronic
1090166074 11:124548922-124548944 CAGAGACAGCAAACTGACACTGG - Intergenic
1091227819 11:133968189-133968211 CAGATACAGCAACGGCACACCGG + Intergenic
1091241240 11:134053815-134053837 CAGACACTGCCGAGGGAACCAGG + Intergenic
1091445428 12:542115-542137 CAGAAACAGAAGTGGGAGACTGG - Intronic
1092112098 12:5971116-5971138 CAGAAATAGCAGAGGGACTGTGG + Intronic
1092247289 12:6870769-6870791 CATACACAGCACAGAGGCACGGG - Exonic
1092593637 12:9975830-9975852 TGCACACAGCAGAGGGACCCTGG - Intronic
1092662700 12:10755713-10755735 TGCACACAGCAGAGGGACCCTGG + Intergenic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1094489286 12:30948626-30948648 TGCACACAGCAGAGGGACCCTGG + Intronic
1095847168 12:46758805-46758827 TGCACACAGAAGAGGGACACTGG - Intergenic
1096038029 12:48490116-48490138 AAGACATAGCAGAGGGCCAGAGG + Intronic
1096039194 12:48499865-48499887 CAAACACTGCAGAAGGCCACAGG - Intergenic
1096113763 12:49043296-49043318 GGGGCACAGCAGAGGGACAGAGG + Intronic
1096177539 12:49532928-49532950 CAGACAGACAAGAGGGGCACAGG - Intergenic
1096324500 12:50647302-50647324 GTGACACAGAAGAGGGAGACGGG + Intronic
1096701045 12:53383007-53383029 CAGACACCCCAGAGGGTCAGTGG + Exonic
1096904891 12:54926490-54926512 TGCACACAGCAGAGGGACCCTGG - Intergenic
1097522775 12:60689392-60689414 GAGCCCCAGCAGAGGGACCCTGG + Intergenic
1098630890 12:72720568-72720590 TGCACACAGCAGAGGGACCCTGG - Intergenic
1101597708 12:106181845-106181867 GAGAGACAGCTGAGTGACACAGG - Intergenic
1101631548 12:106499921-106499943 CAGACACAGCAGAGAGGCAAAGG - Intronic
1103012196 12:117466012-117466034 CACACACAGGTGAGGGACACAGG + Exonic
1103079867 12:118015475-118015497 GGAACACAGCAGAGGGACAGTGG - Intronic
1103091025 12:118098207-118098229 CAGAGAGAGCAGTGGGACAGTGG - Intronic
1103191223 12:119003657-119003679 CAGAAAGATCAGAGGGACACTGG + Intronic
1104754442 12:131260313-131260335 GAGACACAGCAGTGTGACGCGGG - Intergenic
1104819382 12:131666012-131666034 GAGAGACAGCAGAGACACACAGG - Intergenic
1105781173 13:23706240-23706262 AGGAAACAGCAGAGGGGCACAGG + Intergenic
1106077772 13:26475836-26475858 CAGACACAGCAGCGGGATCACGG - Intergenic
1106917319 13:34529564-34529586 TGCACACAGCAGAGGGACCCTGG - Intergenic
1107261901 13:38502550-38502572 AATACACTGCAGAGGGGCACAGG - Intergenic
1107707107 13:43119196-43119218 CAGGCAAAGCAGAGGATCACTGG - Intergenic
1108247528 13:48532886-48532908 CAGAGACAGCTGAGGGGCCCAGG - Intronic
1108270565 13:48755774-48755796 TGCACACAGCAGAGGGACCCTGG - Intergenic
1108840771 13:54611792-54611814 CAGAAACAGGATAGGGACAGGGG - Intergenic
1109245921 13:59954728-59954750 TAGTCACAGCAGAAGGACAAAGG + Intronic
1109337137 13:61007905-61007927 TGCACACAGCAGAGGGACCCTGG - Intergenic
1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG + Intergenic
1111083088 13:83337765-83337787 TACACACAGCACAGGGATACTGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111459400 13:88519910-88519932 TACACACAGCAGAGGGACCCTGG - Intergenic
1111546103 13:89738543-89738565 GAGACACTTCACAGGGACACAGG + Intergenic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1113145799 13:107205826-107205848 CAGAGGCAGCAGAGGAGCACAGG - Intronic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1114450100 14:22819765-22819787 CAGAAAAAGCAGAGGGTAACGGG + Intronic
1114798175 14:25740210-25740232 TGTACACAGCACAGGGACACTGG + Intergenic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1115622198 14:35152073-35152095 CAGACACTGCGGAGGGCCGCAGG - Intronic
1116079747 14:40156787-40156809 TGCACACAGCAGAGGGACCCTGG + Intergenic
1116133602 14:40891756-40891778 TACACACAGCAGAGGGACCCTGG + Intergenic
1116164142 14:41311755-41311777 TGGACACAGCAGAGAGACTCTGG - Intergenic
1116275209 14:42824229-42824251 TACACACAGCACAGGGACCCTGG - Intergenic
1116387356 14:44348146-44348168 TGCACACAGCAGAAGGACACTGG - Intergenic
1117256741 14:53985800-53985822 TGTACACAGCAGAGGGACCCAGG - Intergenic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1118163380 14:63312971-63312993 CAGTCACAGCGGATGGCCACGGG + Exonic
1118653863 14:67925960-67925982 CGCACACAGCACAGGGACCCTGG + Intronic
1120247949 14:82027905-82027927 TGCACACAGCAGAGGGACCCTGG + Intergenic
1120818118 14:88884273-88884295 TACACACAGCAGAGGGACCATGG + Intergenic
1121246667 14:92465677-92465699 CAGGCACAGTCGAGTGACACAGG - Intronic
1121379592 14:93451545-93451567 GAGACACATCAGAGGGTCTCCGG - Intronic
1122262514 14:100531415-100531437 AGGACACAGTAGGGGGACACTGG - Intergenic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1125260984 15:37824330-37824352 AAGGCACAGCAGCGGCACACAGG - Intergenic
1125304248 15:38291759-38291781 TACACACAGCACAGGGACAGTGG + Intronic
1125662795 15:41407480-41407502 CAGACAGATGAGAGGGAGACGGG + Intergenic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1125983729 15:44028634-44028656 CAGACACACCAGAGGCTCAGGGG + Intronic
1126666529 15:51080539-51080561 AAGAAACAGGAGATGGACACAGG - Intronic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1128812851 15:70585142-70585164 AAGACAGAGCAGCGGGACCCGGG + Intergenic
1132230970 15:100184007-100184029 CAGAGACAGCAGGGAGACAAGGG + Intronic
1132743708 16:1428234-1428256 CCGACACAGCTGAGGGACGGCGG - Intergenic
1132938904 16:2497282-2497304 CAGCCACAGACGAGGGACATCGG + Intronic
1133156038 16:3876992-3877014 CAGACACATCTAAGTGACACTGG + Intronic
1133449685 16:5893503-5893525 CAGATAAAACAGATGGACACAGG - Intergenic
1135843289 16:25895715-25895737 CTCACACAGCAGAGGGAAAGAGG + Intronic
1136233342 16:28900553-28900575 GAGATACAGCAGAGAGCCACAGG - Intronic
1138675027 16:58645020-58645042 CAGTGACAGCAGGGGGCCACTGG + Intergenic
1138895410 16:61198580-61198602 TGCACACAGCAGAGGGACCCTGG - Intergenic
1139812803 16:69636729-69636751 CACACACAGCATGGGGACCCTGG + Intronic
1139966187 16:70746677-70746699 CAGCCACAGAAGAAAGACACAGG + Intronic
1140806275 16:78535179-78535201 CAGAGGCTGCAGATGGACACAGG + Intronic
1140854339 16:78964798-78964820 TACACACAGCACAGGGACCCAGG - Intronic
1141030482 16:80583575-80583597 CAAACACAGCAGTGGCACAATGG + Intergenic
1141609145 16:85171289-85171311 CAGATGTAGCAGATGGACACGGG - Exonic
1142304178 16:89276269-89276291 CGGACACAGGAGAGGGAGACAGG + Intronic
1142511093 17:393901-393923 TAAGCACAGCAAAGGGACACAGG + Intergenic
1143152997 17:4818651-4818673 CAGAATCAGGAGGGGGACACGGG - Intronic
1143258696 17:5582872-5582894 GAGACACATCAGAGGGGCAGGGG + Intronic
1143517779 17:7428667-7428689 GAGAAACAGGAGAGGGTCACTGG + Intergenic
1144037638 17:11381773-11381795 CAGACACAGCACAGCCCCACAGG - Intronic
1144765600 17:17730873-17730895 CACCCACAGAAGAGTGACACCGG - Intronic
1145753635 17:27373920-27373942 TGCACACAGCAGAGGGACCCTGG - Intergenic
1146187654 17:30735868-30735890 CAGACACTGCGGAGGGCCACAGG - Intergenic
1146657848 17:34645509-34645531 CAGACACAGAAGAGGGGAAGGGG + Intergenic
1147655762 17:42090019-42090041 GAAACAGATCAGAGGGACACAGG - Intergenic
1148222564 17:45873871-45873893 CTGACACAGCAGAGAAACCCTGG - Intergenic
1150457007 17:65314229-65314251 CTGACACAGCAGAGGGTCTCTGG + Intergenic
1151107318 17:71631393-71631415 CAGACACAGCATATGGATAGGGG - Intergenic
1151195678 17:72429852-72429874 GAGAGAGAGCAGTGGGACACTGG + Intergenic
1151467829 17:74299218-74299240 CAGAGGCAGCAGAGGTACAAAGG + Intronic
1152224965 17:79088544-79088566 TACACCCAGCAGAGGGGCACAGG - Intronic
1152334610 17:79693340-79693362 CAGACACTGGAGGGGGACATAGG + Intergenic
1152813563 17:82393819-82393841 CAGAAACACCAGAGGGCCAGAGG - Intronic
1155675612 18:28425617-28425639 CACACACAGCACGGGGACCCTGG - Intergenic
1155851671 18:30782460-30782482 TACACACAGCACAGGGACCCTGG - Intergenic
1157144431 18:45147292-45147314 CATACACAGAAGATGGAAACTGG - Intergenic
1157144624 18:45149090-45149112 CATACACAGAAGATGGAAACTGG - Intergenic
1157469732 18:47979869-47979891 GATACACAGCAGAGGGCCAAAGG - Intergenic
1159570189 18:70103610-70103632 CAGACACTGCGGAAGGCCACAGG + Intronic
1160697995 19:493890-493912 GAGACAAGGCAGAGAGACACAGG - Intronic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1160953367 19:1678112-1678134 GAGACAGAGGAGAGAGACACAGG - Intergenic
1160961097 19:1721203-1721225 CAGAGCCAGGAGAGGGGCACGGG + Intergenic
1161084757 19:2329683-2329705 CAGCCACAGCAGAGGGATAGCGG - Intronic
1162551440 19:11360621-11360643 CAGGCACAAAAGAGAGACACAGG + Intronic
1162582187 19:11538287-11538309 CCGGCACAGCAGAGGGACTCGGG - Intergenic
1163228110 19:15979262-15979284 CAGACATAGCAGGGGGACATTGG + Intergenic
1163277748 19:16296128-16296150 CAGACACAGCAGGGGTTCTCTGG - Intergenic
1164126167 19:22321213-22321235 CAAACACTGCAGAAGGCCACAGG - Intergenic
1164153663 19:22575222-22575244 CAAACACTGCAGAAGGCCACAGG + Intergenic
1164545482 19:29158319-29158341 CAGATCCAGCAGAGGGGCTCTGG + Intergenic
1164690676 19:30208731-30208753 CAGACCCCGGAGAGGGGCACGGG + Intergenic
1165223969 19:34341060-34341082 CAAATGCAGCAGAGGGACAATGG - Intronic
1166423267 19:42654390-42654412 AAGATACAGAAGAGGGACAGGGG + Intronic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
1167654182 19:50752757-50752779 CAGACACAGCACAAGGTGACGGG + Intergenic
1168084188 19:54033289-54033311 CATACAAAGCAGAGAGACCCCGG - Intergenic
1168189855 19:54730027-54730049 CAGACCCAGAGGAGGGAGACTGG + Intronic
1168199846 19:54806482-54806504 CAGACCCAGAGGAGGGAGACTGG + Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925767168 2:7247268-7247290 CAGACACAGCAAGGGCCCACAGG - Intergenic
925886970 2:8401698-8401720 CAGTCCCAGCATAGGCACACAGG + Intergenic
926062288 2:9812113-9812135 GACACACAGGAGGGGGACACCGG - Intergenic
926156173 2:10455131-10455153 GAGAAACAGCAGAGGCACAGTGG + Intergenic
926456550 2:13074272-13074294 TTCACACAGCAGGGGGACACTGG + Intergenic
926686815 2:15704480-15704502 CAGGCACAACAGAGGGACACTGG - Intronic
926922782 2:17955773-17955795 AAGAGCCAGCAGAGGGACAGTGG + Intronic
927113602 2:19881572-19881594 CAGAGAGAGCAGACAGACACTGG + Intergenic
927928034 2:27026585-27026607 GCGACACAGCAGAGAGACAACGG - Exonic
928197500 2:29226079-29226101 CACATGCAGAAGAGGGACACTGG + Intronic
928259364 2:29752962-29752984 CAGACCCAGCCCAGGGTCACAGG + Intronic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930768919 2:55112579-55112601 CAGACACAGCTGAGGCAGCCCGG - Intronic
931234800 2:60404128-60404150 CAGGCACAGCAGAGGGGTAAGGG - Intergenic
931517556 2:63058970-63058992 CCGACTCAGCAGAGGCCCACAGG + Intergenic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932743144 2:74307418-74307440 CAGCTACAGCCGAGTGACACTGG + Intronic
932847546 2:75151347-75151369 TACACACAGCACAGGGACCCTGG - Intronic
932884976 2:75541420-75541442 AAGACACAGGAGATGGACATAGG + Intronic
933268170 2:80204073-80204095 TGCACACAGCAGAGGGACCCTGG + Intronic
934140300 2:89040472-89040494 CAGACACGGAAGATGGAGACTGG + Intergenic
934221026 2:90083021-90083043 CAGACATGGCAGATGGAGACTGG - Intergenic
934228935 2:90160065-90160087 CAGACACGGAAGATGGAGACTGG - Intergenic
934960453 2:98668270-98668292 TGCACACAGCAGAGGGACCCTGG - Intronic
934972811 2:98776461-98776483 CAGACACAGGAGTGAGACTCTGG - Intergenic
935381286 2:102453293-102453315 CATACAAAGCAGAGAGACACTGG + Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
936813671 2:116433331-116433353 TGCACACAGCAGAGGGACCCTGG + Intergenic
936854257 2:116937459-116937481 CTGACACAATAGAGGGAGACAGG - Intergenic
936870544 2:117130878-117130900 GAGAGACAGCAAAGGGAGACAGG - Intergenic
937228600 2:120383973-120383995 CAGACACAACAGAGGGGCCCAGG + Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
937795335 2:126010882-126010904 CAGACACAGCTGAGAGACTAGGG + Intergenic
938010918 2:127828357-127828379 TACACACAGCAGAGAGACCCTGG - Intergenic
938131326 2:128717968-128717990 GAGACAGAGCTGAGGGACAGAGG + Intergenic
938185106 2:129224652-129224674 CAGACAGGGCACATGGACACAGG + Intergenic
938408565 2:131046006-131046028 GAGAGACAGCAGAGGGTCATGGG - Intronic
939128462 2:138205266-138205288 TGCACACAGCAGAGGGACCCTGG + Intergenic
939224983 2:139353688-139353710 CACACACAGCACGGGGACCCTGG - Intergenic
941468943 2:165860996-165861018 TGCACACAGCAGAGGGACACTGG + Intronic
942044028 2:172088639-172088661 CAGACAGAGCAAAAGGAGACAGG - Exonic
942419942 2:175797279-175797301 TGCACACAGCAGAGGGACGCTGG - Intergenic
942601308 2:177643785-177643807 TGCACACAGCAGGGGGACACTGG - Intronic
943194001 2:184719245-184719267 TGCACACAGCAGAGGGACCCTGG + Intronic
943491332 2:188559189-188559211 TACACACAGCACAGGGACCCTGG - Intronic
944800137 2:203231042-203231064 TACACACAGCAGAGGGACCCTGG - Intergenic
944852227 2:203731735-203731757 CAGACACATCATAGACACACTGG + Intronic
944883380 2:204038531-204038553 TAGACACAGCTGAGGGGCAGTGG - Intergenic
945192388 2:207202883-207202905 CGGACAGAGCAGAGGTAGACTGG + Intergenic
945304944 2:208250717-208250739 CACACAGGGCAAAGGGACACAGG + Intronic
945360087 2:208886555-208886577 TGCACACAGCACAGGGACACTGG - Intergenic
945618661 2:212106739-212106761 TGCACACAGCAGAGGGACCCTGG - Intronic
945815459 2:214600244-214600266 CATACACAGCAGGGAGACATTGG - Intergenic
947361277 2:229347867-229347889 CAGACACAGCAGAGGGCCTAAGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947709900 2:232307081-232307103 CAGGCACGGCACAGGGCCACGGG - Intronic
947909735 2:233793200-233793222 CATTCACAGGAGAGGGAGACCGG + Intronic
948125676 2:235563276-235563298 CAGACACAGCAAAGGGGGGCAGG - Intronic
948504327 2:238417967-238417989 CACACACAGGAGAAGGGCACGGG - Intergenic
948907473 2:240986697-240986719 AGCACACAGCAGAGGGACAAGGG - Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1168841747 20:914277-914299 CAAAGCCAGCAGAGGGACAAAGG + Intronic
1169247336 20:4033936-4033958 CAGACACTGCGGAGGGCCGCGGG + Intergenic
1172195807 20:33090682-33090704 CAGGCAAAGGAGAGGGTCACAGG - Intronic
1173122720 20:40308396-40308418 CAGACACAGCACAGGCAAAAAGG + Intergenic
1173184599 20:40830950-40830972 GAGAGACAGCAAAGGGACAAAGG + Intergenic
1173869493 20:46332568-46332590 CAGAGGCAGCAGCGGGACTCAGG + Intergenic
1174049457 20:47757705-47757727 CCGACACATCAGAGGCTCACTGG - Intronic
1175370385 20:58484361-58484383 AAGGCACAGCACAGGGACTCTGG + Intronic
1175621427 20:60450888-60450910 CAGCCACAGAAGAGGCACAAAGG + Intergenic
1175808848 20:61846576-61846598 GAGACAGAGAAGAGAGACACAGG + Intronic
1176026354 20:62987553-62987575 CAGAGACAGCTGGGGGACCCGGG + Intergenic
1176247521 20:64104524-64104546 CAGACACAGCAGGGGGGCACAGG + Intergenic
1176247556 20:64104661-64104683 CAGACACAGCAGGGGGGTACAGG + Intergenic
1176247582 20:64104759-64104781 CGGCCACAGCAGGGGGGCACAGG + Intergenic
1176247611 20:64104857-64104879 CGGACACAGCAGGGGGGCACAGG + Intergenic
1176827507 21:13714557-13714579 CAGACCCAGCAGTGTGGCACAGG + Intergenic
1176883104 21:14221903-14221925 CTGATACAGCAGAGAGAAACAGG - Intronic
1177218816 21:18164145-18164167 CAGACACAGCAACAGGACCCAGG + Intronic
1177393235 21:20502478-20502500 TGCACACAGCACAGGGACACGGG + Intergenic
1177761013 21:25402260-25402282 TACACACAGCAGGGGGACCCTGG - Intergenic
1178430488 21:32514567-32514589 AACACACAGCAGAGGGGCTCAGG - Intronic
1178498223 21:33104659-33104681 TATACACAGAAGAGAGACACAGG - Intergenic
1179025150 21:37673599-37673621 AGGACACAACACAGGGACACAGG + Intronic
1179492232 21:41748122-41748144 CAGACAACACAGACGGACACCGG + Intronic
1179943433 21:44654474-44654496 CCGGCACAGCAGAGCCACACAGG + Exonic
1179961914 21:44772432-44772454 CAGACCCAGCAGAGGGCCAGGGG - Intronic
1180181250 21:46119580-46119602 CCGACGCAGCAGAGGGACGAGGG + Intronic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1181092481 22:20483510-20483532 CAGCTACAGCTGAGGGACATTGG + Intronic
1181973486 22:26711469-26711491 CAGAGACAGCAGACAGTCACAGG + Intergenic
1182182330 22:28363183-28363205 TATACACAGCAGAGGGACCCTGG - Intronic
1183470084 22:38000565-38000587 CACAGACTGCAGAGGAACACAGG - Intronic
1183661724 22:39225317-39225339 CAGGCCAAGCAGAGAGACACAGG + Intronic
1183703745 22:39464311-39464333 CTGCCACAGGAGAGGGGCACAGG + Intronic
1184111532 22:42398314-42398336 CAGTGACAGCAGAGGAAGACTGG - Intronic
1184507209 22:44911449-44911471 TGCACACAGCAGAGGGACCCTGG - Intronic
1184822193 22:46917774-46917796 CTGACACATCAGAGAGCCACTGG - Intronic
1185310719 22:50152787-50152809 CAGACCCAGGAGAGGAACAGAGG + Intronic
949238999 3:1847187-1847209 CACACACAACAAAGGGACACAGG + Intergenic
949974488 3:9443340-9443362 CAGACACAGCATAGATGCACAGG - Exonic
950615685 3:14156192-14156214 CACACACAGCACACGCACACTGG + Intronic
950626173 3:14248747-14248769 CTGCCACAAAAGAGGGACACAGG - Intergenic
951317540 3:21205150-21205172 CGCACACAGCAGAAGGACCCTGG - Intergenic
951335853 3:21420889-21420911 CAGACAATGCAGAGGGAAATAGG + Exonic
952253770 3:31678261-31678283 TAGAGACACCAGAGGGAGACAGG + Intronic
952309033 3:32170452-32170474 CAGACACTGCGGAGGGCCGCAGG + Intergenic
952329517 3:32351128-32351150 CTGACACAGCAGATGAACATGGG + Intronic
952577173 3:34789477-34789499 CTGGAACAGCAGAGGGACAGTGG - Intergenic
953228735 3:41044534-41044556 CAGACACAGCAAAGAGCCAAAGG + Intergenic
953664932 3:44918585-44918607 CAAACACAGCAGAAGGACGATGG + Intronic
953754129 3:45632013-45632035 TACAAACAGCAGAGGGGCACAGG - Intronic
953854112 3:46487745-46487767 GGAACACATCAGAGGGACACAGG - Intergenic
954117571 3:48475660-48475682 GAGTCACAGCAGAGGGTCAGTGG + Intronic
954365953 3:50146287-50146309 AAGACAAGGCAGAGGGGCACAGG + Intergenic
954809609 3:53240010-53240032 CAGTCACTGCTGAGGGACCCAGG + Intronic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
955021343 3:55124610-55124632 CAGACAACTCTGAGGGACACTGG - Intergenic
955626917 3:60928161-60928183 CAAACACTGCAGAAGGCCACAGG + Intronic
956391612 3:68779493-68779515 TGCACACAGCAGAGGGACCCTGG - Intronic
956837136 3:73104513-73104535 CAGAAACAGAGGAGGGAGACTGG - Intergenic
957276066 3:78093125-78093147 TGCACACAGCAGAGGGACCCTGG - Intergenic
958146495 3:89631451-89631473 CACACACAGCATGGGGACCCTGG - Intergenic
958157342 3:89771596-89771618 TGCACACAGCAGAGGGACCCTGG + Intergenic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
962063394 3:131953095-131953117 CAAACACTGCAGAGGGCCGCAGG + Intronic
962891142 3:139674043-139674065 CAGGGACAGCAGAGAGGCACAGG + Intronic
963251968 3:143111892-143111914 CAGACAGAGGTGAGGGACAGTGG + Intergenic
963363256 3:144303424-144303446 TACACACAGCAGGGGGACCCTGG + Intergenic
964220374 3:154337804-154337826 CAGACACAGTAGAAGCACACAGG - Exonic
964520717 3:157563635-157563657 CACACACAGCACAGGGACCCTGG + Intronic
965058455 3:163752427-163752449 CAGACACAGCACTGATACACAGG - Intergenic
965127511 3:164649535-164649557 CATACACAGCATGGGGACCCTGG - Intergenic
965251512 3:166349694-166349716 TGCACACAGCAGAGGGACATTGG - Intergenic
966059264 3:175734755-175734777 TGCACACAGCAGAGGGACCCTGG + Intronic
966153566 3:176892231-176892253 TGCACACAGCAGAGGGACCCTGG - Intergenic
967176456 3:186865441-186865463 CAGACACTGCGGAGGGCCGCGGG + Intergenic
967404235 3:189098889-189098911 CAGACACTGCAGGGTGACAAGGG - Intronic
968403017 4:315056-315078 TGCACACAGCAGAGGGACGCTGG + Intergenic
968501603 4:952742-952764 CACACACAGCACAGGGCCCCGGG - Intronic
968603787 4:1522043-1522065 CAGGGGCAGCAGACGGACACAGG + Intergenic
968731788 4:2272611-2272633 TTGACACAGCAGAAGCACACAGG - Intronic
968755416 4:2413429-2413451 CACACACAGCTGAGAGAGACCGG + Intronic
968981771 4:3854010-3854032 GTGACACAGCAGACGGACAGAGG + Intergenic
969220038 4:5753342-5753364 CAGGAACTGCAGAGGGACAGAGG + Intronic
969533784 4:7743543-7743565 CAGGCACAGCAGACGCTCACTGG - Intergenic
969594943 4:8143534-8143556 CAGACAAAGCAGTGGGAGAAGGG - Intronic
969828718 4:9778736-9778758 CAGATAGAGCAGAGGGAGAAAGG + Intronic
970357378 4:15269399-15269421 TGCACACAGCAGAGGGACCCTGG - Intergenic
970591769 4:17566062-17566084 CATACACAGTATAGGCACACAGG + Intergenic
971875300 4:32300861-32300883 TAGACACAGCAGAGGGACCCTGG - Intergenic
972370586 4:38419594-38419616 CACACACAGCACAAGGACCCTGG + Intergenic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
972662393 4:41129051-41129073 GAGAGACAGAGGAGGGACACTGG - Intronic
973128618 4:46620912-46620934 CAGACACAGCAGAAGGCTAAAGG - Intergenic
974076832 4:57174770-57174792 CAGAAACAGAATTGGGACACAGG - Intergenic
974206080 4:58705094-58705116 TGCACACAGCAGAGGGACCCTGG - Intergenic
974897580 4:67957856-67957878 TGCACACAGCAGAGGGACCCTGG - Intronic
975063944 4:70038293-70038315 CAAACACTGCAGAAGGCCACAGG + Intergenic
975280160 4:72552833-72552855 AAGACACAGAAGGGGGACAGAGG - Intronic
976471309 4:85432041-85432063 CACACACAGCAGAGTCCCACTGG - Intergenic
976581369 4:86740495-86740517 TCTACACAGCAGAGGGACCCTGG + Intronic
976635643 4:87284377-87284399 TGCACACAGCAGAGGGACCCTGG - Intergenic
976672956 4:87674109-87674131 TGTACACAGCAGAGGGACCCTGG + Intergenic
976947118 4:90783812-90783834 AAGACACAGCCCAGGGATACAGG + Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977383533 4:96308363-96308385 TGCACACAGCAGAGGGACCCTGG - Intergenic
977395789 4:96468951-96468973 TCTACACAGCAGAGGGACCCTGG + Intergenic
977556725 4:98494697-98494719 CAGACACTGTAGAGGCACCCAGG + Intronic
978654737 4:111052011-111052033 CACACACAGCACAGGGACCCTGG - Intergenic
980202753 4:129677132-129677154 TGCACACAGCACAGGGACACTGG - Intergenic
980391755 4:132156113-132156135 TGCACACAGCAGAGGGACCCTGG + Intergenic
981795349 4:148589396-148589418 TGCACACAGCAGAGGGACATTGG - Intergenic
981872892 4:149507911-149507933 TGCACACAGCAGAGGGACCCTGG - Intergenic
982019621 4:151190480-151190502 TGCACACAGCAGAGGGACCCTGG - Intronic
983419645 4:167500969-167500991 TACACACAGCACAAGGACACTGG + Intergenic
984141732 4:176012389-176012411 CAGACCCTGCAGTGGGGCACTGG - Intergenic
985156067 4:186988216-186988238 TGCACACAGCAGAGGGACCCCGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
987016684 5:13827415-13827437 TACACACAGCAGGGGGACCCTGG - Intronic
987075900 5:14381445-14381467 CACAGACATCAGAGGGACAAAGG - Intronic
987102620 5:14605325-14605347 TGTACACAGCAGAGGGACCCTGG + Intronic
988668962 5:33360506-33360528 CACACACAGCACAGGAACCCTGG + Intergenic
989129106 5:38086968-38086990 CTGACACGCCAGATGGACACTGG + Intergenic
989651638 5:43696869-43696891 TGCACACAGCAGAGGGACTCTGG + Intronic
990985082 5:61633949-61633971 CAGCCACAGAAGAAAGACACAGG + Intergenic
991100419 5:62785752-62785774 CAGATAGAGCAGAAGCACACTGG + Intergenic
993478194 5:88390403-88390425 CAGACACCACCGAGAGACACAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993945881 5:94116556-94116578 TGCACACAGCAGAGGGACCCTGG - Intergenic
994878110 5:105451075-105451097 TGCACACAGCAGAGGGACCCTGG - Intergenic
996214356 5:120848975-120848997 AGCACACAGCAGAGGGACCCTGG + Intergenic
996222366 5:120949704-120949726 TTCACACAGCAGAGGGACTCTGG - Intergenic
996811480 5:127520331-127520353 CAGACAGAGCAGATGCAGACAGG - Intronic
997056699 5:130452302-130452324 CACACACAGCACAGGGTCTCTGG + Intergenic
997108267 5:131046090-131046112 TGCACACAGCAGAGGGACCCTGG + Intergenic
997263490 5:132481185-132481207 CAGACACTGAAGAGGGAGACAGG + Intergenic
997274653 5:132574415-132574437 CGCACACAGCAGAGGGACCCTGG + Intronic
997402996 5:133616967-133616989 CAGTAACAGCAGAGGGGAACTGG - Intergenic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
998451589 5:142238798-142238820 GACACACAGAAGAGGGACACAGG - Intergenic
999473664 5:151878599-151878621 CGCACACAGCACAGGGACCCTGG - Intronic
999683873 5:154085085-154085107 CAGGAACAGCAAATGGACACTGG + Intronic
1000101672 5:158022701-158022723 CAGACATGGCAGAGGGAGATGGG - Intergenic
1001284187 5:170410397-170410419 CAGACACAGCATGGGTGCACCGG + Intronic
1001684951 5:173586309-173586331 TGCACACAGCAGAGGGACCCTGG + Intergenic
1001933292 5:175687847-175687869 CAGCCACAGGAAATGGACACAGG - Intergenic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002605239 5:180379203-180379225 GAGACACAGAGGAGAGACACAGG - Intergenic
1002853812 6:1020426-1020448 GAGACACAGCTGAGGGAGGCAGG + Intergenic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1003715589 6:8642659-8642681 CAGGCAGAGAAGAGGCACACAGG - Intergenic
1004067248 6:12260687-12260709 CAGAAACTCCAGAGGGACAGGGG - Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1004409066 6:15363509-15363531 AAGACACAACACAGGGAAACAGG - Intronic
1004467930 6:15903153-15903175 CAGACACAGAGGATGCACACAGG + Intergenic
1005264082 6:24092808-24092830 CAGATCCAGCAGAGGAACCCAGG - Intergenic
1005644234 6:27826317-27826339 CAAACACTGCAGAAGGCCACAGG - Intergenic
1006028706 6:31163615-31163637 TGGACACAGCAGAGGGCAACTGG + Exonic
1007661608 6:43490184-43490206 CACCCACAGCAAAGGGAGACTGG - Intronic
1009625180 6:66130034-66130056 CTAACACAGCAGAAGAACACTGG + Intergenic
1009817002 6:68749047-68749069 TACACACAGCACAGGGACCCTGG + Intronic
1010879874 6:81154042-81154064 AGCACACAGCAGAGGGACCCTGG + Intergenic
1010884332 6:81217975-81217997 TACACACAGCACAGGGACCCTGG - Intergenic
1012752278 6:103179059-103179081 CAGACATGGCTGAGGGACTCTGG + Intergenic
1012930488 6:105311149-105311171 CAGAGAGAGCAGATGGACATTGG - Intronic
1014068172 6:117150899-117150921 TACACACAGCACAGGGACCCAGG + Intergenic
1015053765 6:128875118-128875140 TTCACACAGCAGAGGGACCCTGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015969646 6:138731000-138731022 TACACACAGCACAGGGACCCGGG + Intergenic
1016106625 6:140171439-140171461 TGTACACAGCAGAGGGACCCTGG + Intergenic
1016108144 6:140188372-140188394 TCTACACAGCACAGGGACACTGG - Intergenic
1016253185 6:142071771-142071793 TGTACACAGCAGAGGGACCCTGG - Intronic
1017811724 6:157988533-157988555 GAGACACAGCAGAGAGACACGGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018176499 6:161182785-161182807 AAAACCCAGGAGAGGGACACTGG + Intronic
1018309314 6:162491960-162491982 CAGAGACAGCAGAGGCACCGAGG - Intronic
1018971132 6:168530210-168530232 CAGCCACAGCGGAGGGAAACGGG + Intronic
1019145244 6:169971707-169971729 GAGGCACAGCAGAGAGACAGTGG - Intergenic
1019258099 7:64433-64455 CTGCCCCAGCAGAGGGACAAAGG + Intergenic
1020974592 7:14989053-14989075 CAGACACAGCAGCAGGCAACAGG + Intergenic
1021045542 7:15918605-15918627 CACACAGAGCAGAGCCACACAGG + Intergenic
1022596016 7:31713867-31713889 TGCACACAGCAGAGGGACCCTGG + Intergenic
1025011312 7:55401681-55401703 CAAACACTGCAGAGGGCCGCAGG - Intronic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025572854 7:62599245-62599267 CAAACACTGCAGAAGGCCACAGG - Intergenic
1028790135 7:94844401-94844423 TGTACACAGCAGAGGGACCCTGG - Intergenic
1030144719 7:106341475-106341497 TGCACACAGCACAGGGACACTGG + Intergenic
1031283209 7:119832356-119832378 CAGACACATCTGTGGCACACAGG + Intergenic
1032997622 7:137465456-137465478 TAGAAACAGAAGAGAGACACAGG + Intronic
1033344986 7:140519582-140519604 CAGACAGCTCAGAGGCACACAGG + Intronic
1033586095 7:142775452-142775474 TGGACACAGCAGAGGGAGGCAGG + Intergenic
1034438408 7:151074644-151074666 CAGACACAGTGTAGGGACAAGGG - Intronic
1035475571 7:159141825-159141847 CAGAGAAAGCTGAGGGACAAAGG + Intronic
1035829029 8:2674802-2674824 CAGTGACAGCAGAGAGACCCAGG - Intergenic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1036728596 8:11242184-11242206 CAGCCTCAGCAGACGAACACAGG + Intergenic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1039121913 8:34157326-34157348 CACACACAGCACAGGGATCCAGG - Intergenic
1039438924 8:37581241-37581263 AAGACACAGCAGAGGCTCCCGGG - Intergenic
1039546591 8:38415118-38415140 CAGACGCAGCAGAGGCATAAGGG - Intronic
1039765052 8:40619590-40619612 CTGACACAGAACAGGGAGACAGG + Intronic
1040643756 8:49372746-49372768 GAGAGAAAGCAGAGGGACATTGG + Intergenic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041286798 8:56271518-56271540 CAAACACTGCAGAAGGCCACAGG - Intergenic
1042771522 8:72387757-72387779 CAGCAGCAGCAAAGGGACACAGG + Intergenic
1043363694 8:79505781-79505803 CCGAGACAGCATATGGACACAGG - Intergenic
1043538749 8:81235321-81235343 CAGACACAGCAGATTGAAATAGG - Intergenic
1044010074 8:86984064-86984086 TGAACACAGCAGAGGGACCCTGG - Intronic
1044718539 8:95123709-95123731 TACACACAGCATAGGGACCCTGG - Intergenic
1044720440 8:95140409-95140431 CAGACACAGAAGCAGTACACGGG - Intronic
1045402613 8:101834278-101834300 CAGCCCCAGCAGGGGGACACCGG - Intronic
1045732288 8:105256123-105256145 GACACACAGCACAGGGACCCTGG + Intronic
1046945869 8:119973684-119973706 CAGACACAGCAGCGGTAGCCTGG - Intronic
1047490448 8:125369993-125370015 TGCACACAGCAGAGGGACCCTGG + Intergenic
1048404552 8:134106704-134106726 CACACACAGCATAGGGACCCTGG - Intergenic
1048504969 8:135012993-135013015 TGGACATAGCAGAGGGACCCTGG - Intergenic
1049804106 8:144531164-144531186 CAGGCACAGCTGAAGGGCACAGG + Intronic
1049804118 8:144531223-144531245 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804130 8:144531282-144531304 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804143 8:144531341-144531363 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804155 8:144531400-144531422 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804169 8:144531459-144531481 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804181 8:144531518-144531540 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804195 8:144531577-144531599 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804209 8:144531636-144531658 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804222 8:144531695-144531717 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804236 8:144531754-144531776 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804250 8:144531813-144531835 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804262 8:144531872-144531894 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804276 8:144531931-144531953 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804289 8:144531990-144532012 CAGGCACGGCAGAAGGGCACAGG + Intronic
1049804302 8:144532049-144532071 CAGGCACGGCAGAAGGGCACAGG + Intronic
1051033825 9:12718603-12718625 CATACACAGCAGAGACACTCAGG - Intergenic
1052007068 9:23361308-23361330 TACACACAGCACAGGGACCCAGG + Intergenic
1052124231 9:24755770-24755792 TACACAAAGCAGGGGGACACTGG - Intergenic
1052306527 9:27016294-27016316 CAGACACAACAGAGACACACAGG - Intronic
1052662329 9:31449815-31449837 CACACACACCACAGGCACACAGG + Intergenic
1052701306 9:31941263-31941285 TGTACACAGCAGAGGGACCCTGG - Intergenic
1052915670 9:33922952-33922974 AAGACACAGGTGAGGGACAAAGG - Exonic
1055167865 9:73219104-73219126 TGCACACAGCAGAGGGACCCTGG - Intergenic
1055452684 9:76444950-76444972 CTGTCACACTAGAGGGACACAGG + Intronic
1056630751 9:88291093-88291115 TGGAGACAGCAGAGGGACATGGG - Intergenic
1056756006 9:89382543-89382565 AATACACAGCAGAGGGAACCTGG + Intronic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1056849875 9:90073469-90073491 CAGACACCACTGAGAGACACTGG - Intergenic
1056965655 9:91161253-91161275 CAGACACAGCAACAGGACAGAGG + Intergenic
1057176566 9:93004563-93004585 CAGAAGCAGCAGTGGGACAGAGG - Intronic
1057552584 9:96063077-96063099 CACACACAGCAGAGGGATTATGG - Intergenic
1057825401 9:98369129-98369151 CAGCCACAGCTGAGGAACACTGG + Intronic
1059561669 9:115340573-115340595 CAGTAACAGCAGGGGGACAGGGG + Intronic
1059908159 9:119011716-119011738 GGGACACAGCAGGGGGACAGGGG + Intergenic
1060669614 9:125458357-125458379 CAAACACTGCAGAGGGCCGCAGG - Intronic
1061495578 9:130972397-130972419 GAGACACAGCACAGAGACAGAGG - Intergenic
1061495587 9:130972483-130972505 GAGACACAGCACAGAGACAGAGG - Intergenic
1061495591 9:130972521-130972543 CAGACAGAGCACAGAGACAGAGG - Intergenic
1061510087 9:131055255-131055277 TAGACACAGAACAGGGAGACTGG - Intronic
1061785854 9:133027848-133027870 CAGACAAACTAGAGGGTCACTGG + Intergenic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1061963532 9:134000130-134000152 AAGACACGGCCAAGGGACACTGG + Intergenic
1062319651 9:135984521-135984543 CAGCCACAGGATGGGGACACGGG - Intergenic
1062712421 9:137983873-137983895 CAGACACACCAGGAGGACACAGG - Intronic
1203519849 Un_GL000213v1:34983-35005 CAGACCCAGCAGTGTGGCACAGG - Intergenic
1186980799 X:14955441-14955463 TACACACAGCAGAAGGACACAGG + Intergenic
1187156402 X:16724189-16724211 CAGGCACAGTAGAGTCACACAGG + Intronic
1188196365 X:27240259-27240281 TGCACACAGCAGAGGGACCCTGG - Intergenic
1188879992 X:35480748-35480770 CATCCACAGCAGAGGGACATTGG + Intergenic
1188997575 X:36904756-36904778 TGCACACAGCAGAGGGACCCTGG - Intergenic
1189597506 X:42584937-42584959 CAGCCACAGCAAAGGGTGACTGG + Intergenic
1189723922 X:43949781-43949803 CACACACAGCAGCGGGCCTCAGG + Exonic
1191696556 X:63996475-63996497 CCTAGACAGCAGAGGGACCCTGG - Intergenic
1192238009 X:69308200-69308222 CACACACACCAGATGGAAACGGG + Intergenic
1192920063 X:75696894-75696916 TGCACACAGCAGAGGGACCCTGG + Intergenic
1193918725 X:87400023-87400045 TACACACAGCACAGGGACCCTGG - Intergenic
1197150981 X:123219708-123219730 CTGACACAGCAAAGGGCCTCCGG + Intronic
1197975638 X:132163267-132163289 CACACACAGCTGAGGGACTCTGG - Intergenic
1198912794 X:141633449-141633471 TACACACAGCAGAGGGTCCCTGG - Intronic
1199020286 X:142870436-142870458 TGCACACAGCAGAGGGACCCTGG - Intergenic
1199157640 X:144569468-144569490 CATCCCCAGCAGTGGGACACTGG - Intergenic
1199240818 X:145545464-145545486 TGCACACAGCAGAGGGACCCTGG + Intergenic
1199680472 X:150220996-150221018 CACAGACAGAAGAGGCACACAGG - Intergenic
1200047465 X:153410447-153410469 GACACACAGCTGAGGGCCACCGG + Intergenic
1200069227 X:153519582-153519604 GAGACCCAGCAGAGGGTCCCAGG + Intronic
1200381571 X:155842858-155842880 TGCACACAGCAGAGGGACACTGG - Intergenic
1202015531 Y:20402276-20402298 TGCACACAGCAGAGGGACCCTGG + Intergenic