ID: 1061818718

View in Genome Browser
Species Human (GRCh38)
Location 9:133210811-133210833
Sequence AGATACTGGTTGGGTTCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061818710_1061818718 14 Left 1061818710 9:133210774-133210796 CCTGTGTCCCAGTCTCATTCGCC No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818713_1061818718 -7 Left 1061818713 9:133210795-133210817 CCAACTGTGTCCTTTTAGATACT No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818706_1061818718 27 Left 1061818706 9:133210761-133210783 CCACCCATCTTGCCCTGTGTCCC No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818707_1061818718 24 Left 1061818707 9:133210764-133210786 CCCATCTTGCCCTGTGTCCCAGT No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818711_1061818718 7 Left 1061818711 9:133210781-133210803 CCCAGTCTCATTCGCCAACTGTG No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818708_1061818718 23 Left 1061818708 9:133210765-133210787 CCATCTTGCCCTGTGTCCCAGTC No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818712_1061818718 6 Left 1061818712 9:133210782-133210804 CCAGTCTCATTCGCCAACTGTGT No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data
1061818709_1061818718 15 Left 1061818709 9:133210773-133210795 CCCTGTGTCCCAGTCTCATTCGC No data
Right 1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061818718 Original CRISPR AGATACTGGTTGGGTTCAAC TGG Intergenic
No off target data available for this crispr