ID: 1061820249

View in Genome Browser
Species Human (GRCh38)
Location 9:133223433-133223455
Sequence CAGGGTAAACAGGCTCAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061820238_1061820249 9 Left 1061820238 9:133223401-133223423 CCCACGTTTCCCACGGGAAGGAA No data
Right 1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG No data
1061820239_1061820249 8 Left 1061820239 9:133223402-133223424 CCACGTTTCCCACGGGAAGGAAC No data
Right 1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG No data
1061820234_1061820249 23 Left 1061820234 9:133223387-133223409 CCTGCACTGCGGTTCCCACGTTT No data
Right 1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG No data
1061820242_1061820249 0 Left 1061820242 9:133223410-133223432 CCCACGGGAAGGAACGGAGGAAG No data
Right 1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG No data
1061820243_1061820249 -1 Left 1061820243 9:133223411-133223433 CCACGGGAAGGAACGGAGGAAGC No data
Right 1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061820249 Original CRISPR CAGGGTAAACAGGCTCAGGG CGG Intergenic
No off target data available for this crispr