ID: 1061820334

View in Genome Browser
Species Human (GRCh38)
Location 9:133223884-133223906
Sequence TCCCATTTCTGTTATTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061820334_1061820342 12 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820342 9:133223919-133223941 CCAGGGCTGAGGCTGCACACCGG No data
1061820334_1061820335 -6 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820335 9:133223901-133223923 ATGGGAGCCAGCTCTACCCCAGG No data
1061820334_1061820343 13 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820343 9:133223920-133223942 CAGGGCTGAGGCTGCACACCGGG No data
1061820334_1061820338 1 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820338 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
1061820334_1061820346 28 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820346 9:133223935-133223957 ACACCGGGGTAGGAACAACCTGG No data
1061820334_1061820344 14 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820344 9:133223921-133223943 AGGGCTGAGGCTGCACACCGGGG No data
1061820334_1061820336 -5 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820336 9:133223902-133223924 TGGGAGCCAGCTCTACCCCAGGG No data
1061820334_1061820345 18 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820345 9:133223925-133223947 CTGAGGCTGCACACCGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061820334 Original CRISPR TCCCATTTCTGTTATTTCTG TGG (reversed) Intergenic