ID: 1061820337

View in Genome Browser
Species Human (GRCh38)
Location 9:133223908-133223930
Sequence CCTCAGCCCTGGGGTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061820337_1061820352 30 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820352 9:133223961-133223983 GTGCTCAGGCCTCTGTGGAGAGG No data
1061820337_1061820344 -10 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820344 9:133223921-133223943 AGGGCTGAGGCTGCACACCGGGG No data
1061820337_1061820346 4 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820346 9:133223935-133223957 ACACCGGGGTAGGAACAACCTGG No data
1061820337_1061820351 25 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820351 9:133223956-133223978 GGAAGGTGCTCAGGCCTCTGTGG No data
1061820337_1061820349 16 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820349 9:133223947-133223969 GAACAACCTGGAAGGTGCTCAGG No data
1061820337_1061820345 -6 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820345 9:133223925-133223947 CTGAGGCTGCACACCGGGGTAGG No data
1061820337_1061820348 8 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820348 9:133223939-133223961 CGGGGTAGGAACAACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061820337 Original CRISPR CCTCAGCCCTGGGGTAGAGC TGG (reversed) Intergenic