ID: 1061820345

View in Genome Browser
Species Human (GRCh38)
Location 9:133223925-133223947
Sequence CTGAGGCTGCACACCGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061820334_1061820345 18 Left 1061820334 9:133223884-133223906 CCACAGAAATAACAGAAATGGGA No data
Right 1061820345 9:133223925-133223947 CTGAGGCTGCACACCGGGGTAGG No data
1061820337_1061820345 -6 Left 1061820337 9:133223908-133223930 CCAGCTCTACCCCAGGGCTGAGG No data
Right 1061820345 9:133223925-133223947 CTGAGGCTGCACACCGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061820345 Original CRISPR CTGAGGCTGCACACCGGGGT AGG Intergenic