ID: 1061820345 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:133223925-133223947 |
Sequence | CTGAGGCTGCACACCGGGGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1061820334_1061820345 | 18 | Left | 1061820334 | 9:133223884-133223906 | CCACAGAAATAACAGAAATGGGA | No data | ||
Right | 1061820345 | 9:133223925-133223947 | CTGAGGCTGCACACCGGGGTAGG | No data | ||||
1061820337_1061820345 | -6 | Left | 1061820337 | 9:133223908-133223930 | CCAGCTCTACCCCAGGGCTGAGG | No data | ||
Right | 1061820345 | 9:133223925-133223947 | CTGAGGCTGCACACCGGGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1061820345 | Original CRISPR | CTGAGGCTGCACACCGGGGT AGG | Intergenic | ||