ID: 1061825416

View in Genome Browser
Species Human (GRCh38)
Location 9:133255680-133255702
Sequence GGTGCCCAAGAACCACCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061825416_1061825419 1 Left 1061825416 9:133255680-133255702 CCGCCTGGTGGTTCTTGGGCACC 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1061825419 9:133255704-133255726 CAGTGAACCTCAGCTTCCTCAGG 0: 1
1: 0
2: 4
3: 21
4: 181
1061825416_1061825420 5 Left 1061825416 9:133255680-133255702 CCGCCTGGTGGTTCTTGGGCACC 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1061825420 9:133255708-133255730 GAACCTCAGCTTCCTCAGGACGG 0: 1
1: 0
2: 1
3: 25
4: 277
1061825416_1061825423 9 Left 1061825416 9:133255680-133255702 CCGCCTGGTGGTTCTTGGGCACC 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1061825423 9:133255712-133255734 CTCAGCTTCCTCAGGACGGCGGG 0: 1
1: 0
2: 0
3: 22
4: 233
1061825416_1061825425 28 Left 1061825416 9:133255680-133255702 CCGCCTGGTGGTTCTTGGGCACC 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1061825425 9:133255731-133255753 CGGGCCAGCCCAGCAGCTGCTGG 0: 1
1: 0
2: 11
3: 56
4: 435
1061825416_1061825422 8 Left 1061825416 9:133255680-133255702 CCGCCTGGTGGTTCTTGGGCACC 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1061825422 9:133255711-133255733 CCTCAGCTTCCTCAGGACGGCGG 0: 1
1: 0
2: 6
3: 43
4: 801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061825416 Original CRISPR GGTGCCCAAGAACCACCAGG CGG (reversed) Exonic
903764965 1:25728181-25728203 GGGGCTCAAGATCCACCAGCAGG - Intronic
904922738 1:34021453-34021475 GGTACCGAAGAACCACTGGGTGG - Intronic
908179355 1:61588848-61588870 GTTGGCCAAGAACCACTAGGTGG - Intergenic
908501125 1:64744937-64744959 GGAGCCCGAGAACCACCTCGCGG - Intergenic
908806538 1:67938312-67938334 GGAGCCCAAGAAGGACAAGGAGG + Intergenic
908867715 1:68569987-68570009 GGTGCATCAGAACCACCTGGAGG + Intergenic
915215141 1:154335246-154335268 GGTGCCCAATGGCCACCAGGGGG - Intronic
915905363 1:159873056-159873078 GGTGCGCGAGAACCAGCAGAAGG - Exonic
916498232 1:165364688-165364710 GGTGCCCTGGTACCACCAGAAGG - Intergenic
918139949 1:181711760-181711782 GGTGCCCAAGGAGCAGAAGGGGG + Intronic
920084674 1:203406590-203406612 GGTACCCAAGAAACATCAGCTGG - Intergenic
920501481 1:206488109-206488131 GGCCTCCAAGAACCACCAGCTGG - Intronic
922635736 1:227168795-227168817 GATGCTCAAGAAACACCAGGGGG - Intronic
1066129033 10:32372252-32372274 TGTGCCCTAGAATCACCTGGAGG - Intronic
1070398137 10:76030886-76030908 GGTGACCAAAAGCCACCTGGTGG - Intronic
1072744407 10:97929601-97929623 GTTGCCCAAGATCCACCTAGAGG - Intronic
1075633955 10:124017909-124017931 GGTAGACAAGAGCCACCAGGTGG - Intronic
1076919634 10:133444951-133444973 GGTGCTCAGGACCCACCAAGGGG + Intergenic
1077187875 11:1243530-1243552 GGTGCCCAAGATGCCCGAGGTGG - Exonic
1077188831 11:1247301-1247323 GGTGCCCAAGATGCCCGAGGTGG - Exonic
1078547563 11:12257044-12257066 GGTGTCCTAGAGCCACCAGAGGG - Intronic
1080451204 11:32380313-32380335 GGTGCCCAGGAAAAACCAAGAGG + Intergenic
1080869788 11:36227284-36227306 GGTGGTCCAGGACCACCAGGCGG - Exonic
1083097543 11:60267021-60267043 GGTGCTCGAGCAACACCAGGTGG - Intergenic
1084383953 11:68830389-68830411 GGTGCCCACCAACTCCCAGGTGG + Intronic
1085418636 11:76336925-76336947 GCTGCCCAAGAGCCACCAACAGG - Intergenic
1086400481 11:86457376-86457398 GGTCCCCAAGTACCTCCAGGTGG + Intronic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1090186356 11:124741580-124741602 GGAGCCCAGGAACCTCCATGAGG - Intronic
1095981475 12:47977019-47977041 GAGGCCCAGGAACCACCTGGAGG + Intronic
1096948663 12:55440302-55440324 TTTACCCAAGAATCACCAGGTGG - Intergenic
1101444765 12:104729852-104729874 GGTGAGCAAGGTCCACCAGGTGG + Intronic
1101467385 12:104961835-104961857 GAGGCTCAAGAACCACCATGTGG + Intergenic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1101956516 12:109216884-109216906 GGTGGCCAAGAAGAACCAGCTGG + Exonic
1104037283 12:125106342-125106364 GGTGGCCAAGAACCACCAAAGGG - Intronic
1104418235 12:128613436-128613458 GGTGGTCAAGAACCACCTGTGGG + Intronic
1104929512 12:132330154-132330176 GGGGCCCTGGAGCCACCAGGAGG + Intergenic
1105704651 13:22961515-22961537 TGAGACCAAGAACCACAAGGAGG - Intergenic
1105857606 13:24386567-24386589 GGAGACCAAGAACCACAAGGAGG - Intergenic
1105865174 13:24452482-24452504 GGTGCCCATCAGACACCAGGAGG + Exonic
1108040060 13:46331640-46331662 GGGGACCAAGAGCCACCAAGGGG - Intergenic
1108434363 13:50387204-50387226 GGTGCCCCAGAGACAGCAGGTGG - Intronic
1110416444 13:75258779-75258801 GGTCACCTAGAAGCACCAGGAGG - Intergenic
1112265496 13:97919887-97919909 GGTGCCAGAGAACCAGCAGGAGG + Intergenic
1113739576 13:112701953-112701975 TGTGCTCATGAACCACCAGCTGG - Intronic
1113816185 13:113172799-113172821 GTTGTCCAAGAGCCACCTGGTGG - Intergenic
1114706012 14:24727075-24727097 GATTCCTAAGAACTACCAGGAGG - Intergenic
1117302699 14:54444292-54444314 CGAGACCACGAACCACCAGGAGG + Intergenic
1118112978 14:62743368-62743390 TGTGCACAAGAATCACCTGGGGG + Intronic
1118523721 14:66617100-66617122 GATTCCTCAGAACCACCAGGAGG + Intronic
1119445697 14:74661726-74661748 GGTGCCTAAGGACCACCACAGGG + Exonic
1119784344 14:77301216-77301238 GCTGAGCCAGAACCACCAGGGGG + Exonic
1123072277 14:105647671-105647693 GGTGCCCCAGCGCCATCAGGTGG + Intergenic
1123132497 14:105999803-105999825 GGCGCTCAGGAACCACCAGGGGG - Intergenic
1123132526 14:105999920-105999942 GATGCTCAGGAACCACCAGGGGG - Intergenic
1123144606 14:106116564-106116586 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123146991 14:106141988-106142010 GGTCACTCAGAACCACCAGGGGG - Intergenic
1123147005 14:106142036-106142058 GGTCACTCAGAACCACCAGGGGG - Intergenic
1123147024 14:106142083-106142105 GGTCACTCAGAACCACCAGGGGG - Intergenic
1123156812 14:106234991-106235013 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123187081 14:106530536-106530558 GGTCCCTCACAACCACCAGGGGG - Intergenic
1123207583 14:106728092-106728114 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123212594 14:106775086-106775108 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123582701 15:21730878-21730900 GAAGCTCAGGAACCACCAGGGGG - Intergenic
1123582775 15:21731215-21731237 GGCGCTCAGGAAACACCAGGAGG - Intergenic
1123619351 15:22173474-22173496 GAAGCTCAGGAACCACCAGGGGG - Intergenic
1123619425 15:22173811-22173833 GGCGCTCAGGAAACACCAGGAGG - Intergenic
1127687662 15:61364692-61364714 GATTCCTCAGAACCACCAGGAGG + Intergenic
1129856750 15:78830458-78830480 GGTGCCCAAGTCCGACCAGTGGG - Intronic
1132662902 16:1069495-1069517 GGTCCCCATGATCCCCCAGGAGG + Intergenic
1132805289 16:1772433-1772455 GGTGCCCAAGCACGAGGAGGAGG - Exonic
1132897095 16:2234223-2234245 CCTGCTCAAGAAGCACCAGGAGG + Exonic
1135472592 16:22744635-22744657 GTTGTCCAAGAACCAGCAGAAGG - Intergenic
1136691965 16:32039195-32039217 GGTCACTCAGAACCACCAGGGGG + Intergenic
1136692039 16:32039429-32039451 GGTCACTCAGAACCACCAGGGGG + Intergenic
1136792549 16:32982757-32982779 GGTCACTCAGAACCACCAGGGGG + Intergenic
1136792582 16:32982867-32982889 GGTCACTCAGAACCACCAGGGGG + Intergenic
1136872097 16:33816720-33816742 GGTCCCTCAGAACCACCAGGGGG + Intergenic
1136877274 16:33871187-33871209 GGTCACTCAGAACCACCAGGGGG - Intergenic
1137828967 16:51525857-51525879 GGTGCACAAGAACCATCTGCTGG - Intergenic
1138774001 16:59698466-59698488 GGAGGCCTAGAACCACAAGGTGG - Intergenic
1139537726 16:67588571-67588593 GGTGCCATAGTACCAACAGGAGG - Intronic
1141850225 16:86640112-86640134 GGTGCCCTTGGCCCACCAGGAGG - Intergenic
1203094755 16_KI270728v1_random:1244222-1244244 GGTCACTCAGAACCACCAGGGGG + Intergenic
1203094797 16_KI270728v1_random:1244346-1244368 GGTCACAGAGAACCACCAGGGGG + Intergenic
1203100075 16_KI270728v1_random:1299348-1299370 GGTCCCTCAGAACCACCAGGGGG - Intergenic
1142939216 17:3367637-3367659 AGTGCCCATCAACCAACAGGTGG - Intergenic
1143697830 17:8633135-8633157 AGTGCCAAAGAGCCACCAGGGGG - Intergenic
1145098831 17:20056310-20056332 GGTTCCCAAGCCGCACCAGGTGG - Intronic
1147114154 17:38286411-38286433 GGGTCCCAACAACAACCAGGAGG - Intergenic
1148415451 17:47502779-47502801 GGGTCCCAACAACAACCAGGAGG + Intergenic
1150432474 17:65129332-65129354 GGCCCCCAAGATCCACCTGGAGG - Intergenic
1151366316 17:73618623-73618645 GGTGCCCAAGAACGGCATGGGGG + Intronic
1151822761 17:76506125-76506147 TGTGCCCAAGAACGCACAGGTGG + Intergenic
1151889427 17:76943427-76943449 TGTGCCCAAGAGTCACCCGGGGG + Intronic
1156280667 18:35634380-35634402 GGTTCCCAAGACCCACCCGTAGG + Intronic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1161455893 19:4369595-4369617 GGTACCAAAGACCCACCTGGTGG + Intronic
1162064617 19:8117429-8117451 GGTGCCCAGGGGCCAGCAGGTGG + Intronic
1162225895 19:9222082-9222104 GGTGCCAAAGACTCACAAGGGGG - Intergenic
1162933385 19:13968429-13968451 GATGCCCGAGAACCAGCAGGGGG - Intronic
1163276483 19:16287662-16287684 GGTGACCATGAACTCCCAGGGGG + Intergenic
1163827737 19:19533029-19533051 GGTGCCCAAGACCCAGGAGGTGG - Intronic
1167083953 19:47296398-47296420 GGTGACCAGGAATCACCTGGGGG + Intronic
1168136028 19:54352359-54352381 GGCCCCCAAGCACCACCTGGGGG - Exonic
925201216 2:1968931-1968953 GGTGCCCCAGAAGCACCTAGGGG - Intronic
925309649 2:2873570-2873592 GGTGCAGAAGAAGCACCAGGTGG + Intergenic
926576702 2:14590204-14590226 TGTGCACAAGAATCACCTGGAGG - Intergenic
934164609 2:89282701-89282723 GGTGCCCAAGAAACCAAAGGAGG + Intergenic
934202665 2:89899823-89899845 GGTGCCCAAGAAACCAAAGGAGG - Intergenic
941081488 2:161066152-161066174 GCTGCTCTAGAAGCACCAGGTGG + Intergenic
945761715 2:213923072-213923094 GTTGCCCTGGAAACACCAGGAGG - Intronic
946160303 2:217831654-217831676 GGTGCCGAGGAACCACCCTGAGG + Intronic
948148981 2:235729583-235729605 GGTCCCCAAGAATAACCAAGTGG - Intronic
948505716 2:238426066-238426088 GGTGGCCCAGATGCACCAGGGGG - Intergenic
1170778471 20:19401960-19401982 TGAGCCCAAGAAACACCAGTAGG - Intronic
1173636908 20:44567664-44567686 GGTGCACAAGAAACACAAGCTGG - Intronic
1175795602 20:61768975-61768997 GGTTCTGAAGCACCACCAGGCGG + Intronic
1176013078 20:62910940-62910962 GGAGCCCGAGAACGATCAGGGGG - Exonic
1179309062 21:40180877-40180899 GGTGCCCAGTGACCACCAAGAGG - Intronic
1180874357 22:19168258-19168280 GGTGGCCATGAGCCACCAGGAGG + Intergenic
1181310218 22:21940594-21940616 GTTGCCCACAAACCACCAGAAGG + Intronic
1181573999 22:23782536-23782558 GGAGCCCAGCCACCACCAGGTGG - Intronic
1183201398 22:36387708-36387730 TGAGCCCAAGAACCACCAGTCGG + Intronic
1183315182 22:37133182-37133204 GGGGCGCAAGAACGACAAGGAGG + Intronic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
1184845745 22:47084503-47084525 CGTGCTCCAGAACCACCTGGAGG - Intronic
949130738 3:497547-497569 AGTGTGTAAGAACCACCAGGAGG + Intergenic
952000909 3:28784935-28784957 GGGCCCCAAGACCCAACAGGAGG + Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953629381 3:44599982-44600004 GAGGCCCTAGAACCTCCAGGAGG + Intronic
953683919 3:45061167-45061189 GGAGCCCCAGAATCACCTGGAGG + Intergenic
953877878 3:46676725-46676747 GGTGCCCAGGACCCACCCTGAGG - Exonic
954249353 3:49356205-49356227 GGTGCCCGAGAAGCAGCAGCTGG + Intergenic
954327358 3:49870778-49870800 GGAGGCTCAGAACCACCAGGAGG + Intergenic
954462107 3:50633179-50633201 GGTGCCCAAGAAACATTGGGGGG - Intronic
959452750 3:106523429-106523451 GATTCCTCAGAACCACCAGGAGG - Intergenic
960565375 3:119126439-119126461 GATTCCTCAGAACCACCAGGAGG - Intronic
961520643 3:127465730-127465752 GGAGCCCAGGTAGCACCAGGTGG + Intergenic
965418151 3:168423221-168423243 GATGAACAAGAGCCACCAGGGGG + Intergenic
965538700 3:169851163-169851185 GGTGGGCATGATCCACCAGGAGG + Intronic
966595513 3:181721780-181721802 GGTACCCAAGAACCAGGAGTGGG - Intergenic
969261357 4:6036150-6036172 GGTGGACAGGAACCACCAGAAGG + Intronic
970015357 4:11506619-11506641 GGGGACCAAGAAACAGCAGGAGG - Intergenic
982528264 4:156506155-156506177 GATTCCTAAGAACTACCAGGAGG - Intergenic
982643863 4:157997552-157997574 AGTGCCCAAGAAACCACAGGAGG + Intergenic
985512569 5:320948-320970 GGGGGCCAAGGACCACCGGGAGG + Intronic
985849281 5:2376711-2376733 GGTGCCCAAGAACAGCCACAGGG + Intergenic
986316974 5:6595928-6595950 GGTTCCCAAGACCCACCCGTGGG - Intergenic
991965796 5:72089390-72089412 GGATCTCATGAACCACCAGGGGG - Intergenic
992601576 5:78406158-78406180 GGTGTCTAAGAATCACCATGGGG + Intronic
997235695 5:132270919-132270941 GCAGCCCAACAACCAGCAGGCGG + Exonic
998702968 5:144725702-144725724 GGTGCCCATAAACCAACAAGTGG - Intergenic
999714670 5:154350881-154350903 GGTACACCAGAATCACCAGGAGG + Intronic
1002319015 5:178364164-178364186 GGGGCCCAGAAACCAACAGGCGG - Intronic
1004493521 6:16141118-16141140 GGTACCGAAGAACATCCAGGTGG + Intronic
1005932812 6:30496497-30496519 GGTGCCCAGGAACCCCTATGTGG - Intergenic
1008107579 6:47456024-47456046 TGTGCCTCAGAACCACCTGGAGG + Intergenic
1009935586 6:70231042-70231064 GGTGCAGCAGAACCACCAGGAGG + Intronic
1013246864 6:108295087-108295109 GGTAACCAAGAGCGACCAGGAGG - Exonic
1013289532 6:108708453-108708475 GGTGAACAAGAACCACAAGAAGG + Intergenic
1013461163 6:110376780-110376802 TGTGCCCCAGAAGCACCAGAAGG - Intergenic
1019951321 7:4375413-4375435 GGTGTCTAAGAACCACCTGCAGG + Intergenic
1022981774 7:35611135-35611157 GGTGTTCAGGAACCAGCAGGAGG + Intergenic
1023352010 7:39329755-39329777 GGCTCCCAAGAAAAACCAGGAGG - Intronic
1024060269 7:45692290-45692312 GGTGCCCAATAAGCACCTGTTGG - Intronic
1024405591 7:48975920-48975942 GCTGCCCAGGAAGCACCAAGGGG - Intergenic
1025186813 7:56867037-56867059 TGTGCTCAAGAACCACTAGCAGG + Intergenic
1025685109 7:63709879-63709901 TGTGCTCAAGAACCACTAGCAGG - Intergenic
1025835710 7:65091633-65091655 TGTGCTCAAGAACCACTAGCAGG - Intergenic
1025905489 7:65781097-65781119 TGTGCTCAAGAACCACTAGCAGG - Intergenic
1026671597 7:72395663-72395685 GGGGTCCAAGAATCTCCAGGAGG + Intronic
1029495417 7:100893680-100893702 GGTGTCCATGAACTACCGGGTGG - Exonic
1032926777 7:136614870-136614892 GGTTCCTGAGAACTACCAGGAGG + Intergenic
1033241035 7:139680321-139680343 GGTGCCCAAGCAGCCCCAGTAGG + Intronic
1035283070 7:157789337-157789359 GCTGCCCCGGGACCACCAGGAGG - Intronic
1035334147 7:158114765-158114787 GGTCCCCAAGAACTACCACAGGG + Intronic
1035406785 7:158604051-158604073 GGTGCCCCTTAGCCACCAGGAGG - Intergenic
1035600182 8:892705-892727 GGAGACCGGGAACCACCAGGCGG + Intergenic
1036802509 8:11802913-11802935 GATGCCCAAGATGGACCAGGTGG + Exonic
1039293809 8:36127528-36127550 GATTCCTCAGAACCACCAGGAGG + Intergenic
1039792752 8:40888585-40888607 GGTGCCCCAGAGCCCCCAGGTGG + Intronic
1041317731 8:56581903-56581925 GGTGCACTAGAGCCCCCAGGAGG + Intergenic
1043645744 8:82516515-82516537 GCTCCCCAAGAACCACCAGAAGG - Intergenic
1044733139 8:95248877-95248899 GGTGCCCATTGACCACCAGAGGG - Intronic
1045063726 8:98427830-98427852 AGCACCCAAGACCCACCAGGAGG + Intronic
1045650793 8:104340128-104340150 GGCTCCCCATAACCACCAGGAGG - Intronic
1045977366 8:108144979-108145001 GGTGTCCAAGATCCTGCAGGAGG + Intergenic
1048868552 8:138778675-138778697 TGTGCCTATGAACCACCAGGAGG + Intronic
1052369285 9:27645732-27645754 GATTCCTCAGAACCACCAGGAGG - Intergenic
1057998977 9:99846445-99846467 GGTGCCCTGGAACTTCCAGGTGG - Intronic
1060539425 9:124419736-124419758 GGCGACCAAGAGCCTCCAGGCGG + Intergenic
1060742322 9:126107430-126107452 GGTGGCCTAGAACCTCCTGGAGG + Intergenic
1061083712 9:128387107-128387129 GCTCCCCCAGAACCACAAGGAGG + Intronic
1061265364 9:129501713-129501735 GGTGCCCAAGAAAGCCCAGAAGG - Intergenic
1061358487 9:130124484-130124506 GGTCCCAGAGAACCACCTGGGGG - Intronic
1061825416 9:133255680-133255702 GGTGCCCAAGAACCACCAGGCGG - Exonic
1189679263 X:43498306-43498328 GGTTGCTAACAACCACCAGGAGG - Intergenic
1194218829 X:91167053-91167075 GGTGCTCTACAATCACCAGGTGG + Intergenic
1196708486 X:118738337-118738359 GGGGCCGAAGAACCACCTGTTGG - Intronic
1198227990 X:134664139-134664161 GGTGCCTCAGAATCACCTGGAGG + Intronic
1198664752 X:139008192-139008214 GGTGGAGAAAAACCACCAGGTGG - Intronic
1200013425 X:153139227-153139249 GGTGTCCAAAAGCCACCAGATGG + Intergenic
1200026176 X:153260691-153260713 GGTGTCCAAAAGCCACCAGATGG - Intergenic
1200555338 Y:4630807-4630829 GGTGCTCTACAATCACCAGGTGG + Intergenic