ID: 1061825848

View in Genome Browser
Species Human (GRCh38)
Location 9:133257735-133257757
Sequence GTCCAATGTTGAGGGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061825848_1061825856 11 Left 1061825848 9:133257735-133257757 CCAGCCCTCCCTCAACATTGGAC 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1061825856 9:133257769-133257791 CACAGCAAGCTGAGCTTTGCTGG No data
1061825848_1061825857 23 Left 1061825848 9:133257735-133257757 CCAGCCCTCCCTCAACATTGGAC 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1061825857 9:133257781-133257803 AGCTTTGCTGGCAAAGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061825848 Original CRISPR GTCCAATGTTGAGGGAGGGC TGG (reversed) Intronic
900357162 1:2270540-2270562 GTGCAGTGTTGAGGGGGCGCTGG + Intronic
900575802 1:3381959-3381981 GGCCAGTGGTGAGGGAGGGGGGG + Intronic
900726192 1:4217897-4217919 GACCAAGAGTGAGGGAGGGCGGG + Intergenic
901663622 1:10814164-10814186 GTCCAAGGCTGAGGCATGGCAGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902806248 1:18863105-18863127 GACCTGAGTTGAGGGAGGGCAGG - Intronic
904400962 1:30256501-30256523 GTCACATGTTGAGTGAGGGCTGG + Intergenic
907407104 1:54260392-54260414 GCCCAGTGGTCAGGGAGGGCAGG + Intronic
908822271 1:68100880-68100902 GTCCCATGTTCATGGTGGGCTGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911754422 1:101536680-101536702 CTCCAATGTTGGAGGTGGGCTGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915064402 1:153212753-153212775 CTCCAATCTTGCTGGAGGGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916179487 1:162070975-162070997 GTCCACCGTTGGGGGAGGGGTGG + Intronic
916575887 1:166066087-166066109 CTGCCATGTTGAGGGACGGCGGG + Intronic
921172019 1:212558709-212558731 GTCCAAGGCCGAGGGAGGGGCGG + Intergenic
921785035 1:219219851-219219873 GTCCTCTGTTGAGGTATGGCAGG + Intergenic
922505809 1:226124864-226124886 GTGAAATGCAGAGGGAGGGCTGG - Intergenic
922764064 1:228148585-228148607 GTCCACGGTGGAGGGAGAGCAGG + Intronic
923476074 1:234332502-234332524 GTCCTATGTGGTTGGAGGGCAGG - Intergenic
1062768224 10:81137-81159 GTCCCATGATGAGGATGGGCTGG - Intergenic
1063535289 10:6876917-6876939 GTCCTAGGGTGATGGAGGGCAGG + Intergenic
1063698030 10:8356560-8356582 GTCAAATATTGAGGAAGGGAGGG - Intergenic
1068892128 10:62159019-62159041 GTCCTTTGTTGAGGGATGGCTGG - Intergenic
1069989802 10:72308256-72308278 GGCCAAGGATGAGGGAAGGCCGG + Intergenic
1072295532 10:94005932-94005954 GTTCAATATTGTGTGAGGGCTGG - Intronic
1072717237 10:97760172-97760194 GTCCAATGGAGTGGGAGGCCAGG + Exonic
1074669038 10:115766650-115766672 TTCCACTGTAGAGGGAAGGCGGG + Intronic
1075240914 10:120777610-120777632 GTCCAATGTAGAGGCAGTGTAGG + Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077222404 11:1423612-1423634 GTCCAAGGTCCAGGGTGGGCTGG + Intronic
1079166287 11:18046330-18046352 GGCCAATGAGAAGGGAGGGCCGG + Intergenic
1079562125 11:21834844-21834866 TTCCAATTTTGAGGGAGAGATGG - Intergenic
1079958563 11:26894294-26894316 TTCCAATGTTGAAGGTGGGTGGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1084936500 11:72589872-72589894 GTCCACTGTAGAGCGGGGGCGGG - Intronic
1087050127 11:93878497-93878519 CTTCAATGATGAGGGAAGGCAGG - Intergenic
1088903724 11:114138112-114138134 GGCAAGTGGTGAGGGAGGGCAGG + Intronic
1089627815 11:119762623-119762645 GTTCAATGTTGGGGGTGGGGTGG + Intergenic
1093027463 12:14258057-14258079 CTGCAATGTTGGGGGAGGGGAGG + Intergenic
1094156012 12:27337541-27337563 GACCCATCTAGAGGGAGGGCAGG - Intronic
1094316923 12:29145541-29145563 GTCCAATGGCCAGGCAGGGCAGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096402758 12:51320992-51321014 GTCCCATGTTGAGTTTGGGCGGG + Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097246973 12:57612012-57612034 GTCCAGTGTTGAGTGGGGGGCGG + Intronic
1102261596 12:111446509-111446531 GTCCAATGGGCTGGGAGGGCTGG + Intronic
1103063335 12:117876293-117876315 ATCCCCTGCTGAGGGAGGGCTGG + Intronic
1103918743 12:124388856-124388878 GTCCCACGGTGAGGGAGGGAGGG + Intronic
1105701115 13:22936237-22936259 GTGCAATGTTGACGGAGGCATGG + Intergenic
1107420332 13:40240110-40240132 GGCCAGTGTGGAGGGAGGGCAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108092074 13:46859491-46859513 CTCCAATGTGGAGGTGGGGCTGG + Intronic
1110522697 13:76499299-76499321 GTCCAAAGGAGAGGGAGGGAGGG + Intergenic
1113491267 13:110693896-110693918 GTGAAATGTTGAGGAAGGGCTGG - Intronic
1114447133 14:22797496-22797518 GTCCACTTTTGAGTGAAGGCTGG - Intronic
1114453016 14:22838635-22838657 GGCCAATGTGGAGGGAAAGCTGG + Intronic
1115023696 14:28714716-28714738 GTCCAATGCTGAGAGTGGGATGG - Intergenic
1115386615 14:32805246-32805268 GTTCAATGTTGCGGGAAGTCAGG - Intronic
1117914635 14:60664324-60664346 TGCAAATCTTGAGGGAGGGCAGG - Intergenic
1118710163 14:68512264-68512286 ATCCAAATTTGAGTGAGGGCTGG + Intronic
1119084788 14:71729978-71730000 GACCAAGGTTGGGGGAGGGTGGG - Intronic
1119449794 14:74699495-74699517 GTCCACGGTTGAGGGTGGCCAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120513233 14:85440460-85440482 TTCCAATGGGGAGGGAGGGCAGG + Intergenic
1122375576 14:101254809-101254831 GTCCTTTGTTCTGGGAGGGCTGG + Intergenic
1123931644 15:25174831-25174853 GACCAGTGTTGAGGGAAGTCAGG - Intergenic
1124661148 15:31551973-31551995 CCCCAATGTTGAGGGGGGCCTGG + Intronic
1126652439 15:50938276-50938298 GTCCTTTGGTGAGAGAGGGCAGG - Intronic
1127315474 15:57790427-57790449 GTCCATTGTTGAGGTTGGGTGGG + Intergenic
1129723919 15:77892026-77892048 GTCCAACGAGGCGGGAGGGCTGG - Intergenic
1131273194 15:90959349-90959371 CTCCAGTGTTGTGGGAGGCCAGG + Intronic
1131739559 15:95373029-95373051 GTGCACTGTTCAGGGAGGGCCGG + Intergenic
1132092146 15:98955626-98955648 GTGCAACCTTGAGGGAGGGTGGG - Intronic
1132117245 15:99146409-99146431 GACCAATGGTCAGGGATGGCTGG - Intronic
1133827019 16:9287119-9287141 CTCCAAAGTCCAGGGAGGGCTGG + Intergenic
1135170543 16:20179491-20179513 GTCCTATGTGGATGGAGGACAGG + Intergenic
1135679289 16:24443037-24443059 GTTAATTGTTGAGGTAGGGCTGG - Intergenic
1137499201 16:48997561-48997583 GTCCTGAGTCGAGGGAGGGCTGG - Intergenic
1142959420 17:3543223-3543245 GGCCACTGTTCAGGCAGGGCTGG - Intronic
1144197325 17:12907054-12907076 ATCCAATATTTATGGAGGGCAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1147974713 17:44240155-44240177 GTCCAATGTTGAGGCCAGGGTGG - Intergenic
1148047288 17:44751895-44751917 GGGCAATGGTGAGGAAGGGCAGG - Exonic
1152294670 17:79459633-79459655 GGCCAGTGTTGAGGGTGGCCTGG - Intronic
1152694791 17:81738706-81738728 GCCCAGTGTCGAGGGAGGGCCGG - Intergenic
1153678902 18:7481285-7481307 GTCCATGGTGGAAGGAGGGCGGG + Intergenic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1156083264 18:33366374-33366396 GTGCAATGATGAGGAAGGACAGG - Intronic
1157504766 18:48218514-48218536 GTGCCATGTAGAGAGAGGGCTGG - Intronic
1158613336 18:58962931-58962953 TTCCAGTGTTGTGGCAGGGCTGG + Intronic
1160752374 19:740501-740523 GGCCCAGGTGGAGGGAGGGCAGG - Intronic
1161326337 19:3665963-3665985 GTCGGCTGTGGAGGGAGGGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163503910 19:17692824-17692846 GGCCTATGTGGAGGGAGGGAAGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927909329 2:26885490-26885512 GTGCCATTTTGGGGGAGGGCTGG - Intronic
929439650 2:41955189-41955211 GCCCAAAGGTGAAGGAGGGCTGG - Intergenic
930872837 2:56184981-56185003 GTCACCTGTTGAGGGAGGGAGGG - Intronic
931925727 2:67070432-67070454 GTCTAATGATGAGGGAGGGTGGG + Intergenic
934659258 2:96134428-96134450 GTCCCATGTTCAGGGAAGCCTGG - Intronic
935090947 2:99894324-99894346 GTTGAATGTTGAGGGAAGGGAGG + Intronic
937838419 2:126497839-126497861 GGCCAGTGTTGAGGGAAGTCAGG - Intergenic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
943150504 2:184106718-184106740 GTCCAATGTAGAGGGTGGATAGG + Intergenic
943247505 2:185473951-185473973 ACCCAATGCTGACGGAGGGCAGG - Intergenic
943877184 2:193084058-193084080 GTCCAATGTAGAGGGATTGATGG - Intergenic
945115970 2:206408529-206408551 TTCCATTGTTGAGAGAGGGCAGG - Intergenic
946301026 2:218824137-218824159 GCCCGATGTTCAGGGATGGCTGG + Intronic
948080872 2:235204071-235204093 GTGCTGTGTTGAGGGTGGGCTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168774329 20:435398-435420 GTCCAATGTTGTGGCAGAGGCGG - Intergenic
1169077237 20:2768660-2768682 GTCCCTTGTTGAGTGAGGACGGG + Intergenic
1169192800 20:3668674-3668696 CTCCACTGGTGAGGGAGGTCAGG + Exonic
1171099075 20:22365448-22365470 GTCAAAGGATGAGGAAGGGCAGG - Intergenic
1173380782 20:42538812-42538834 GTCCAATGTGGAGAGTGGGCAGG - Intronic
1174300774 20:49580474-49580496 GTCCACTGTAGGGGGAGGGTGGG - Intergenic
1174966088 20:55217020-55217042 GTTCAATGATGAAGCAGGGCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179237649 21:39561657-39561679 GTCCAAGTTTTAGGGTGGGCTGG - Intronic
1179270518 21:39847124-39847146 GTCCAAAGTTGAGGTGGGGTGGG + Intergenic
1180600476 22:17012204-17012226 GTCCCATGTTGAGGCTGAGCTGG + Intergenic
1181943728 22:26499015-26499037 GTTCAATGGGCAGGGAGGGCTGG - Intronic
1182520709 22:30883116-30883138 GTGCAGGGATGAGGGAGGGCGGG + Intronic
1183171001 22:36188197-36188219 GCCCAATGTGGAGGAAGAGCTGG + Intergenic
1183506335 22:38211133-38211155 ATCCTGTGTTGAGGAAGGGCGGG + Intronic
1183835018 22:40445155-40445177 GTGCAAAATTGAGGGAGGGAAGG - Intronic
949941900 3:9161534-9161556 GTCCAATGTGGAGATAGAGCAGG - Intronic
950590021 3:13930272-13930294 GTCCAAAGTAGATAGAGGGCAGG + Intergenic
953661536 3:44894642-44894664 GTCAAATCTTGGGGGAGGGGAGG - Intronic
953773848 3:45799247-45799269 GTCCTTTGTAGGGGGAGGGCGGG - Intergenic
959729357 3:109583298-109583320 GTCCAATGTTGCAGGAAGTCAGG + Intergenic
962630695 3:137272550-137272572 GGCCAATGTGGAGGCAGGGTAGG + Intergenic
963052156 3:141151566-141151588 GTGCTATGTTGTGGGAGGGTTGG - Intergenic
964077963 3:152714689-152714711 GTCCAATGTAGCTGGAGGCCTGG - Intergenic
965506424 3:169520357-169520379 GTCCAAGGATGAGGGAGGTTGGG - Intronic
970538588 4:17055214-17055236 ATTCAGTGTTGAGAGAGGGCTGG - Intergenic
972279080 4:37585516-37585538 GAGAAATGTTGAGGGAGGGGAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974761770 4:66285542-66285564 GCCCAGTGCTGATGGAGGGCAGG + Intergenic
979505010 4:121485569-121485591 GATCTATGTTGAGGGAGGGTGGG + Intergenic
980073347 4:128266325-128266347 GTCCTATGTTGTGGGAAGTCAGG - Intergenic
981722573 4:147816202-147816224 GTGGAATGTTTAGGGAAGGCTGG + Intronic
983164203 4:164454571-164454593 GTCCAATGCTGAGGGCTGGGTGG - Intergenic
991237210 5:64412636-64412658 TTCCAATGTGTAGGGAGGCCTGG + Intergenic
998452612 5:142246438-142246460 GTCCATTCTGGAGGGATGGCTGG + Intergenic
1000453618 5:161421032-161421054 GGCCAATGGTGAGGGAAGGAGGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003230935 6:4253228-4253250 GTTGAATGTTGAGAGAGGGTGGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007165513 6:39826053-39826075 GTCCAATGGGGAAGGAGGCCAGG - Intronic
1007407683 6:41644355-41644377 GGGCAATGGGGAGGGAGGGCTGG - Intronic
1008887385 6:56445771-56445793 GTCTTATTTTGAGGGAAGGCAGG + Intergenic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1011590931 6:88970235-88970257 CTCCAATGTTGCGGGAAGTCAGG - Intergenic
1013346748 6:109268120-109268142 GTCCGATGTTGCGGGAAGTCAGG + Intergenic
1013646970 6:112154231-112154253 ATCCAAGGGTGAGGGAGGGAAGG - Intronic
1013833118 6:114298620-114298642 GTCCTATGTTGCGGGAAGGCAGG + Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016350352 6:143160122-143160144 ATTCACTGTTGAGGGAGGGAAGG - Intronic
1017980404 6:159396011-159396033 GCCCAATTTTGAGGGTGGGGTGG - Intergenic
1018062057 6:160097818-160097840 GTCCACTGTTAAGGGTGGGCAGG - Intronic
1018481831 6:164198989-164199011 GTGCAGTGTTGAGGTCGGGCAGG + Intergenic
1021053768 7:16021374-16021396 GCCCAATGTTGAGAGATGGATGG + Intergenic
1022690624 7:32648915-32648937 GTCCCAGGTTGGGGGAGGGGTGG - Intergenic
1022918181 7:34982757-34982779 GTCCCAGGTTGGGGGAGGGGTGG - Intronic
1023677622 7:42646984-42647006 GTCCAAGGTTGAGGGGGCGGGGG - Intergenic
1028885728 7:95930515-95930537 GTCTAAGGTGGAGGGAGGTCTGG + Intronic
1032628938 7:133625770-133625792 GTCGAATGATGATGGATGGCTGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034589744 7:152129102-152129124 GTCCGATGTTGAGGGAGAAAAGG + Intergenic
1037566101 8:20119742-20119764 GTCCAATCTTCTGGGAGGTCAGG + Intergenic
1039485134 8:37904136-37904158 GTCCAAGCTGGAGGCAGGGCAGG - Intergenic
1041632631 8:60104928-60104950 GGTAAATGTTGAGGGAGTGCTGG + Intergenic
1042717937 8:71795287-71795309 GTGCAAGGTTGAGCCAGGGCAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047749696 8:127870982-127871004 GTCCAGTGACTAGGGAGGGCAGG + Intergenic
1049965910 9:779731-779753 GTCGAATGTTGCGGGAAGTCAGG + Intergenic
1051664121 9:19452180-19452202 TTCCATTGTTGGGAGAGGGCAGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1055257040 9:74384129-74384151 GCCCAGAGTTGGGGGAGGGCAGG + Intergenic
1055566988 9:77579370-77579392 GTCTATTGTTGGGGAAGGGCAGG - Intronic
1056045425 9:82710785-82710807 GTCTTATTTTGTGGGAGGGCAGG + Intergenic
1056811943 9:89771806-89771828 TTCCAATGCTGAGTGGGGGCTGG + Intergenic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1057458048 9:95232277-95232299 CTCCAATGTTGAGGGTGAGTGGG - Intronic
1058007789 9:99938065-99938087 CTCCAGTGTTGAGTGAGTGCTGG + Intronic
1061780048 9:132990024-132990046 GGCCACTGCTGATGGAGGGCTGG + Intronic
1061825848 9:133257735-133257757 GTCCAATGTTGAGGGAGGGCTGG - Intronic
1061959632 9:133981460-133981482 CTCTGATGCTGAGGGAGGGCAGG + Intronic
1062276833 9:135735373-135735395 CACCCATGCTGAGGGAGGGCTGG - Intronic
1062424576 9:136500186-136500208 AGCCAAGGTTGAGGGAGGGGCGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186416094 X:9384235-9384257 GTCCAATGTCTGCGGAGGGCTGG + Intergenic
1188542404 X:31265545-31265567 GACCAAAGTTGAGGGTGGGTAGG - Intronic
1189392522 X:40588337-40588359 GTCAAATGTTGGGGGGGGGGGGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1196580946 X:117378438-117378460 GGCCAATGTTGAGAGAGCCCAGG - Intergenic
1196755666 X:119155301-119155323 TACAAATGTTGGGGGAGGGCTGG - Intergenic
1197882094 X:131177732-131177754 GTCCACTGATGAGTGAGGGCTGG + Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic