ID: 1061825967

View in Genome Browser
Species Human (GRCh38)
Location 9:133258396-133258418
Sequence CCTCCCAGCCTTAAGTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 366}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061825967_1061825975 18 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825975 9:133258437-133258459 TCAATTCACTGTGGGCAGAGAGG No data
1061825967_1061825974 10 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825974 9:133258429-133258451 GTTGTGTCTCAATTCACTGTGGG No data
1061825967_1061825976 21 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825976 9:133258440-133258462 ATTCACTGTGGGCAGAGAGGAGG No data
1061825967_1061825977 25 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825977 9:133258444-133258466 ACTGTGGGCAGAGAGGAGGCTGG No data
1061825967_1061825973 9 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825973 9:133258428-133258450 GGTTGTGTCTCAATTCACTGTGG No data
1061825967_1061825978 26 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061825967 Original CRISPR CCTCCCAGCCTTAAGTCAAG TGG (reversed) Intronic
901364835 1:8738037-8738059 TGTCCCACCCCTAAGTCAAGAGG + Intronic
903231775 1:21926720-21926742 TCTCCCAGCCTGAAGTGTAGTGG - Intronic
904207109 1:28862612-28862634 CCTCCCAGCCTTTGTTCAAGGGG - Intronic
906930688 1:50166838-50166860 CCTCCTACCTTTAAGTCAACAGG - Intronic
907349950 1:53820748-53820770 CCTCCCAGACTCAAGTGAAGTGG + Intronic
908737631 1:67292491-67292513 CCTCCTACCTTTAAGTCAACAGG + Intergenic
909048472 1:70739121-70739143 CATCCCAGCCTCTTGTCAAGTGG + Intergenic
909548716 1:76875498-76875520 CCTCCTACCTTTAAGTCAACAGG - Intronic
909577158 1:77187519-77187541 CCTCCTACCTTTAAGTCAACAGG + Intronic
910790524 1:91045123-91045145 CCTCCTACCTTTAAGTCAACAGG + Intergenic
910830861 1:91461735-91461757 CCTCCTACCTTTAAGTCAACAGG - Intergenic
911108933 1:94163019-94163041 CCTCCTACCTTTAAGTCAACAGG - Intronic
911738173 1:101360248-101360270 CCTCCTACCTTTAAGTCAACAGG - Intergenic
911843287 1:102712162-102712184 CCACCCAGGCTGAAGTGAAGTGG - Intergenic
911883799 1:103272150-103272172 CCTCCTACCTTTAAGTCAACAGG + Intergenic
911980640 1:104561101-104561123 CCTCCTACCTTTAAGTCAACAGG + Intergenic
912050473 1:105523255-105523277 CCTCCCACCTTTAAGCCAACAGG - Intergenic
912188993 1:107315633-107315655 CCTCCCAGCCTTGAGTCCCAAGG + Intronic
912251801 1:108019794-108019816 CCTCCTACCTTTAAGTCAACAGG - Intergenic
912733087 1:112127149-112127171 CCTCCCATCTTTAAGTCAACAGG - Intergenic
915742198 1:158127313-158127335 ACTCCCAGCATTAAGTGAAGAGG + Intergenic
915981292 1:160421429-160421451 CCTCACAGGCTGAAATCAAGAGG + Intronic
916105957 1:161432611-161432633 CCTCCTACCTTTAAGTCAACAGG - Intergenic
917747416 1:178024190-178024212 CCACCCAGGCTTAAGTGCAGTGG - Intergenic
918755487 1:188336132-188336154 CCTCCTACCTTTAAGTCAACAGG - Intergenic
918774729 1:188612423-188612445 CCTCCTACCTTTAAGTCAACAGG + Intergenic
918958466 1:191239621-191239643 CCTCCCACCTTTAAGTCAACAGG + Intergenic
921058240 1:211560924-211560946 CCTCCCAGCCTTCAGCCAAGTGG + Intergenic
922780821 1:228250920-228250942 CCTCCTACCTTTAAGTCAACAGG - Intronic
923253349 1:232197762-232197784 CCTCCTACCTTTAAGTCAACAGG - Intergenic
924840542 1:247706143-247706165 CCTCCTATCTTTAAGTCAACAGG - Intergenic
924846905 1:247783460-247783482 CCTCCTATTCTTAAGTCAACAGG - Intergenic
1063327199 10:5116238-5116260 CCTCCTACCTTTAAGTCAACAGG - Intronic
1063788358 10:9410194-9410216 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1064517353 10:16166097-16166119 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1065387440 10:25147628-25147650 CCACCCAGCCTGCAGTGAAGTGG + Intergenic
1068447428 10:57140272-57140294 CCTCCTACCTTTAAGTCAATAGG + Intergenic
1069790591 10:71017896-71017918 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1070395497 10:76008336-76008358 CCCTCCAGCCTTCAGTCAATGGG - Intronic
1071301470 10:84258836-84258858 CCTCTCAGCCTTGAGTGTAGGGG - Exonic
1071937911 10:90550948-90550970 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1071942549 10:90606096-90606118 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1072209027 10:93230025-93230047 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1073208370 10:101780429-101780451 ACTCCCAGCCTCTAGTCAAGGGG - Intergenic
1075082110 10:119391185-119391207 CCTCTCAGGCCTCAGTCAAGAGG - Intronic
1075607029 10:123819090-123819112 CCTCCTACCTTTAAGTCAACAGG + Intronic
1077018889 11:408754-408776 GCTCCCTGCCTTCAGTCCAGTGG - Exonic
1077995825 11:7451704-7451726 CCTCACAGCTTCAAGTCCAGTGG - Intronic
1080076829 11:28159176-28159198 CCTCCTACCTTTAAGTGAAGAGG + Intronic
1081038754 11:38183711-38183733 TCTCCCAGGCTGAAGTCCAGTGG + Intergenic
1081378519 11:42387577-42387599 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1082671917 11:56044689-56044711 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1082783918 11:57306236-57306258 GCTCCCAGCCTGAAGTGCAGTGG - Intronic
1085577739 11:77621975-77621997 CTTGCCAGCCTTCAGTCACGTGG + Intronic
1085748558 11:79137227-79137249 CCTTCCACCTTTAAGTCAACAGG + Intronic
1085937904 11:81172030-81172052 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1086278835 11:85162100-85162122 CCTCCCACTTTTAAGTCAACAGG + Intronic
1088191444 11:107233026-107233048 CCTCCTACCTTTAAGTCAATAGG - Intergenic
1088990769 11:114951521-114951543 AGGCCCAGCCTGAAGTCAAGGGG + Intergenic
1089162216 11:116447298-116447320 CCTCCCTGCATTTAGTAAAGTGG + Intergenic
1089329214 11:117678184-117678206 CCTCCCAGCCTGGAGTCAGCTGG + Intronic
1089903852 11:122015273-122015295 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1090221387 11:125029974-125029996 CCTCCTACCTTTAAGTCAATAGG - Intronic
1090952414 11:131485244-131485266 CCTCCCAGCCTCCTGTCAAGAGG - Intronic
1091761149 12:3088180-3088202 TCTCCCAGGATTAAGACAAGTGG - Intronic
1092093856 12:5825612-5825634 CCTCCTACCTTTAAGTCAACAGG + Intronic
1093031581 12:14293955-14293977 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1093049441 12:14489323-14489345 CCTCCTACCTTTAAGTCAACAGG - Intronic
1093645946 12:21585314-21585336 CCTCCCACCTTTAAGTCAACAGG + Intronic
1093964768 12:25312588-25312610 CCTCCTATCCCTAAGTCAACAGG + Intergenic
1093981386 12:25479134-25479156 CCTCCTACCTTTAAGTCAACAGG - Intronic
1094102761 12:26780923-26780945 CCTCCTACCTTTAAGTCAACAGG + Intronic
1094693401 12:32792567-32792589 CTTCCCAGGGTCAAGTCAAGTGG + Intronic
1095844160 12:46728312-46728334 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1095856024 12:46862028-46862050 CCTCCGACCTTTAAGTCAACAGG - Intergenic
1096289002 12:50324913-50324935 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1096802134 12:54117645-54117667 CCTCACAGCCTTCTGTCTAGTGG - Intergenic
1097077230 12:56404054-56404076 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1097322479 12:58241496-58241518 CTTCCAAGACTTAAGACAAGTGG - Intergenic
1097843108 12:64341091-64341113 CCTCCTACCTTTAAGTCAACAGG - Intronic
1098181927 12:67856411-67856433 GGTCCCAGCCCAAAGTCAAGCGG - Intergenic
1098731326 12:74039354-74039376 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1098736398 12:74111106-74111128 TCTCCTACCCTTAAGTCAACAGG - Intergenic
1098750055 12:74281255-74281277 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1099028398 12:77494424-77494446 CATCTAAGCTTTAAGTCAAGAGG - Intergenic
1099526581 12:83724747-83724769 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1099578281 12:84407059-84407081 CCTCCTACCCTTAAGTCAACAGG + Intergenic
1100240910 12:92709943-92709965 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1102966570 12:117132334-117132356 TCTCCCAGGCTGGAGTCAAGTGG + Intergenic
1103035863 12:117655729-117655751 CCTCCTACCTTTAAGTCAACAGG + Intronic
1103120841 12:118377899-118377921 TCTCCCCTCCTTCAGTCAAGAGG - Intronic
1103848835 12:123918039-123918061 CCTGCCTGGCTTAAGTCAAAAGG + Intronic
1104810377 12:131616910-131616932 CCTCCCAGCCAGGAGTCATGAGG + Intergenic
1104837154 12:131799133-131799155 GCTCCCAGCCTTTCATCAAGGGG + Intronic
1106562574 13:30859361-30859383 CCTGCCAGCCTTAAGTTAAGAGG - Intergenic
1107983350 13:45754303-45754325 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1108904497 13:55451620-55451642 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1109931833 13:69226073-69226095 CCTCCCACCTCTAAGTCAACAGG + Intergenic
1109950797 13:69500555-69500577 CCTCCTATCTTTAAGTCAACAGG - Intergenic
1110833911 13:80062959-80062981 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1111535424 13:89596829-89596851 CCTCCTACCTTTAAGTCAAAAGG + Intergenic
1111536085 13:89604951-89604973 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1112202117 13:97286897-97286919 CCTCCCAGCCTTACATTCAGTGG - Intronic
1112230890 13:97588507-97588529 CCTCCTACCTTTAAGTCAATAGG - Intergenic
1112249712 13:97768676-97768698 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1114130500 14:19786174-19786196 CCTCCCAGCCTGGAGTGCAGTGG - Intronic
1114208681 14:20597688-20597710 CCTCCCAGCCTGGAGTGCAGGGG + Intronic
1114294078 14:21313746-21313768 CCACCCAGGCTGAAGTCCAGTGG - Intronic
1115059933 14:29175543-29175565 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1116158169 14:41234995-41235017 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1116207719 14:41889901-41889923 TCTCCCAGGCTTGAGTGAAGTGG + Intronic
1118752292 14:68816218-68816240 CCTCCGAGCCTCAAGTGAATTGG - Intergenic
1118950527 14:70432915-70432937 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1119695329 14:76708928-76708950 GCACCCAGCCTTGAGCCAAGTGG - Intergenic
1119698128 14:76730410-76730432 CCTCCCAGTCTTAAAACATGAGG - Intergenic
1120081792 14:80225871-80225893 CCTCCTACCTTTAAGTCAACAGG - Intronic
1120555791 14:85928977-85928999 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1123955311 15:25328594-25328616 CCTCCCTTCCTTTATTCAAGGGG - Intergenic
1124858293 15:33412252-33412274 CTTCCCAGCCTCAAGCCAAAGGG - Intronic
1125175968 15:36822109-36822131 CATCCCAGCCTTATATCAAAAGG - Intergenic
1125973164 15:43928637-43928659 TCTCCCAGTCCTAAGTCCAGGGG + Intronic
1126141619 15:45444074-45444096 GCTCCCAGCTTAAAGTCAAAGGG - Intronic
1127357015 15:58209894-58209916 CCTCCTAGCTTTAAGGCAACAGG + Intronic
1127572866 15:60261395-60261417 CCTCCCAGCCAAAAGGGAAGAGG + Intergenic
1128033848 15:64505880-64505902 CCTCCCAGGCTCAAGCCAGGAGG - Intronic
1128308086 15:66613231-66613253 CCTTCCAGCCTTCTGTCTAGAGG - Intronic
1129434335 15:75525883-75525905 TCTCCCAGACTGAAGTGAAGTGG - Intronic
1129678045 15:77643000-77643022 CCTCCCAGAGCTAAGTCCAGTGG - Intronic
1132217837 15:100080285-100080307 CCTCCCACCTTTAAGTCAACAGG + Intronic
1138403664 16:56770415-56770437 TCCCTCAGCCTTAACTCAAGGGG - Intronic
1138868608 16:60852435-60852457 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1139438036 16:66948178-66948200 CCTCCCTGCCTTTGCTCAAGCGG + Intergenic
1140717251 16:77737891-77737913 CCACCAAGACTTCAGTCAAGTGG - Intronic
1141559306 16:84856375-84856397 CCTCCTCCCCTTAAGTCAACAGG - Intronic
1144516904 17:15924698-15924720 TCGCCCAGCCTTAAGTGCAGTGG - Intergenic
1145827113 17:27885289-27885311 CCTCCCAGCATCAAGTTTAGTGG - Intronic
1146238256 17:31187882-31187904 CCTCCTACCTTTAAGTCAACAGG + Intronic
1148484150 17:47979825-47979847 CCTCCCAGCCTCAAGGGGAGAGG + Intronic
1149682905 17:58518047-58518069 CCTCCCAGCCTTTAGCCAATCGG + Intergenic
1154068691 18:11132742-11132764 CCTCCTACCTTTAAGTCAACAGG + Intronic
1156184219 18:34642461-34642483 CAACCCAGCCTGAAGTAAAGTGG - Intronic
1156304079 18:35860355-35860377 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1156998807 18:43499388-43499410 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1157341439 18:46781672-46781694 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1159558878 18:69973721-69973743 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1160795988 19:945649-945671 CCTCCCACCCTAGAGTCAAGAGG - Intronic
1161001239 19:1912304-1912326 CCGCCCAGCCTCACCTCAAGCGG + Exonic
1163634376 19:18431477-18431499 CCTCCCACCCTCAAGCCATGAGG + Intronic
1165905457 19:39191759-39191781 TCTCCCAGGCTGAAGTCCAGGGG - Intergenic
925105321 2:1286041-1286063 TCTCCTAACTTTAAGTCAAGAGG - Intronic
925280187 2:2678509-2678531 CCTCCTACCTTTAAGTCAACAGG + Intergenic
925460966 2:4062105-4062127 CCTCCTAACTTTAAGTCAAGAGG + Intergenic
926769958 2:16362115-16362137 ACTCACAGCCTGAGGTCAAGTGG - Intergenic
926810165 2:16749051-16749073 CCTCCAATCTTTAAGTCAACAGG - Intergenic
929509738 2:42557201-42557223 CCTCCCAGGCTGAAGTGCAGTGG - Intronic
930294975 2:49543718-49543740 CCTCCTACCTTTAAGTCAACAGG - Intergenic
930536395 2:52650604-52650626 CCTCCTACCTTTAAGTCAACAGG - Intergenic
930674935 2:54190469-54190491 CCTCCAAGTGTTAAGTCCAGTGG + Intronic
934055168 2:88245239-88245261 CCACCCAGCCTGGAGTCCAGTGG - Intergenic
934116926 2:88807501-88807523 CTGCCCTGCCTTGAGTCAAGTGG - Intergenic
934763960 2:96870108-96870130 CCCCCCAGCCTGACGTCAAGGGG - Intronic
935424879 2:102909675-102909697 CCTCCTACCTTTAAGTCAACAGG - Intergenic
935564075 2:104588597-104588619 CCTCCTACCTTTAAGTCAACAGG - Intergenic
937802556 2:126097213-126097235 CCTCCTACCTTTAAGTCAACAGG + Intergenic
937852348 2:126647093-126647115 CCTCCTACCTTTAAGTCAACAGG - Intergenic
938374697 2:130797848-130797870 CCTCCCAGCCTCTAGGAAAGCGG - Intergenic
939629884 2:144517721-144517743 CCGCCTAGCCCTGAGTCAAGCGG - Intronic
939788450 2:146544453-146544475 CCTCCTACCTTTAAGTCAACAGG - Intergenic
940537259 2:154960762-154960784 CCTCCCAGGCTGGAGTCCAGTGG - Intergenic
941668255 2:168262759-168262781 CCTCCTACCTTTAAGTCAACAGG + Intergenic
943021156 2:182575379-182575401 CCTCCTATCTTTAAGTCAACAGG - Intergenic
943239054 2:185361329-185361351 CCTCCTACCTTTAAGTCAATAGG - Intergenic
945511929 2:210713609-210713631 CCCTCTAGCCTTCAGTCAAGAGG - Intergenic
945642408 2:212445498-212445520 CCTCCTACCTTTAAGTCAACAGG + Intronic
945717611 2:213379011-213379033 CCTCCTACCTTTAAGTCAACAGG - Intronic
946527596 2:220538024-220538046 CCTCCTACCTTTAAGTCAACAGG - Intergenic
946527645 2:220538430-220538452 CCTCCTACCTTTAAGTCAACAGG - Intergenic
947441081 2:230121913-230121935 CCTCCTACCTTTAAGTCAACAGG + Intergenic
947853467 2:233307144-233307166 CCTCCCAGGCTGAAGTGCAGTGG - Intergenic
1170380511 20:15754896-15754918 CCTCCCAGGCTGGAGTCCAGTGG + Intronic
1171348109 20:24481423-24481445 CCTCCCAGCATGGTGTCAAGGGG + Intronic
1171794577 20:29556819-29556841 CCTCACAGCCTTCTGTCTAGTGG + Intergenic
1171853874 20:30327445-30327467 CCTCACAGCCTTCTGTCTAGTGG - Intergenic
1172206638 20:33167253-33167275 CTTCCCAGCCTGAGGCCAAGTGG + Intronic
1173685334 20:44919370-44919392 CCTCCCCGGCCTAAGCCAAGAGG + Intronic
1174703197 20:52630159-52630181 CCTCCCACACTTAAGGGAAGGGG - Intergenic
1175855723 20:62119914-62119936 CCTCCCTGCCTTCAGTCCGGGGG + Intergenic
1179326427 21:40350736-40350758 GCTCCCTGCCTTAATTCATGTGG - Intronic
1179414910 21:41190874-41190896 CCTCCTACCTTTAAGTCAACAGG - Intronic
1181373490 22:22437520-22437542 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1182965907 22:34520736-34520758 TCTCCTACCCTTAAGTCAACAGG + Intergenic
1183585988 22:38753253-38753275 CCTCCCAGGCTGAAGTGCAGTGG + Intronic
1184603322 22:45556704-45556726 CCTCCTACCTTTAAGTCAACAGG - Intronic
1184666065 22:45989782-45989804 CTTCCCACCCTTAAAGCAAGAGG - Intergenic
1184783767 22:46662095-46662117 CGTCCCAGCCGTAAGTGAACCGG - Intronic
1185040692 22:48502559-48502581 TCTCCCAGCCTGGAGTGAAGTGG + Intronic
1185237267 22:49721461-49721483 GCTCCCAGCCTGAACTCCAGGGG + Intergenic
949169801 3:984948-984970 CCTCCTACCTTTAAGTCAACAGG - Intergenic
949445844 3:4132719-4132741 CCTCCGACCTTTAAGTCAACAGG + Intronic
949639133 3:6015180-6015202 CCTCCTACCTTTAAGTCAACAGG + Intergenic
951086774 3:18520934-18520956 CCTCCTACCTTTAAGTCAACAGG + Intergenic
955307075 3:57844352-57844374 TCACCCAGCCTGAAGTGAAGTGG - Intronic
956485237 3:69715836-69715858 TCTCCCAGGCTTGAGTGAAGTGG + Intergenic
956590827 3:70912834-70912856 TCTCCCAGCCTGAAGTGCAGTGG - Intergenic
956703672 3:71981241-71981263 CCTCCTACCTTTAAGTCAACAGG - Intergenic
957247343 3:77732246-77732268 CCTCCTACCTTTAAGTCAACAGG - Intergenic
958258785 3:91355080-91355102 CCTCCTACCTTTAAGTCAACAGG - Intergenic
958637276 3:96761628-96761650 CCTCCCAGCCTAAAGACACAAGG + Intergenic
958845557 3:99260768-99260790 CCTCCTACCTTTAAGTCAACAGG - Intergenic
959745791 3:109775618-109775640 CCTCCTACCTTTAAGTCAACAGG - Intergenic
959998101 3:112699952-112699974 CCTCCTACCTTTAAGTCAATAGG + Intergenic
960349743 3:116577361-116577383 CCTCCTACCATTAAGTCAACAGG + Intronic
960494522 3:118359101-118359123 CCTCCTACCTTTAAGTCAACAGG - Intergenic
962478608 3:135779319-135779341 CCTCCCAGCTTCAAGCCCAGTGG - Intergenic
963379020 3:144505625-144505647 CCTCCTACCTTTAAGTCAACAGG - Intergenic
963630534 3:147724875-147724897 CCTCCTACCTTTAAGTCAACAGG + Intergenic
964146735 3:153472997-153473019 CCTCCTACCTTTAAGTCAACAGG + Intergenic
965226534 3:165999118-165999140 CCTCCTAGCTTTAAGTCCACAGG - Intergenic
965291531 3:166887929-166887951 CCTCCTACCTTTAAGTCAACAGG - Intergenic
965603048 3:170473455-170473477 CCACCCAGCCTGAGGTCAGGTGG - Intronic
965996001 3:174884014-174884036 CCTCCTACCCTTAAGTCAACAGG - Intronic
966445917 3:180000230-180000252 CCTCCTACCTTTAAGTCAACAGG + Intronic
968800422 4:2739788-2739810 CCTCCTACCTTTAAGTCAACAGG + Intergenic
968907249 4:3460070-3460092 CCTCCTACCTTTAAGTCAACAGG + Intergenic
968942984 4:3648788-3648810 CCTCCCAGCCTTATGAGATGCGG + Intergenic
969719308 4:8884573-8884595 CATTACAGGCTTAAGTCAAGGGG - Intergenic
971100787 4:23464764-23464786 CCTCCTACCTTTAAGTCAACAGG - Intergenic
971229657 4:24790822-24790844 AATCACAGCCTTAATTCAAGGGG - Intronic
971687155 4:29785434-29785456 CCTCCTACCTTTAAGTCAACAGG - Intergenic
971979082 4:33731214-33731236 CCTCCTACCTTTAAGTCAACAGG - Intergenic
971990208 4:33882616-33882638 CCACCCATCCTTAGCTCAAGAGG - Intergenic
972806157 4:42531034-42531056 CCTCCTACCTTTAAGTCAACAGG + Intronic
973092803 4:46158741-46158763 CCTCCTACCTTTAAGTCAACAGG + Intergenic
974644398 4:64673131-64673153 CCTCCTACCTTTAAGTCAACAGG - Intergenic
977430991 4:96929853-96929875 CCTCCTACCTTTAAGTCAACAGG + Intergenic
977489864 4:97698420-97698442 CCTCCTACCTTTAAGTCAACAGG - Intronic
977701518 4:100028239-100028261 CCTCCTACCTTTAAGTCAACAGG - Intergenic
977898933 4:102396246-102396268 CCTCCTACCTTTAAGTCAACAGG + Intronic
978771919 4:112466127-112466149 CCTCCTACCTTTAAGTCAACAGG - Intergenic
978898839 4:113925168-113925190 CCTCCTACCTTTAAGTCAACAGG - Intronic
979507340 4:121513641-121513663 CCTCCTAGCTTTAAGTCAACAGG - Intergenic
981080273 4:140633262-140633284 ACTCTCAACCTTACGTCAAGTGG + Intronic
981132568 4:141174169-141174191 TTGCCCAGCCTTTAGTCAAGTGG - Intronic
981835228 4:149045561-149045583 CCTCCTACCTTTAAGTCAACAGG + Intergenic
982790935 4:159590879-159590901 TCCCCCAGCCTCAAGTCCAGGGG + Intergenic
983582913 4:169326473-169326495 CCTCCTACCTTTAAGTCAACAGG + Intergenic
983582920 4:169326506-169326528 CCTCCTACCTTTAAGTCAACAGG + Intergenic
985901810 5:2802078-2802100 CTTCCCAGCCATCAATCAAGGGG - Intergenic
986087360 5:4464546-4464568 CCTCCTAACTTTAAGTCAACAGG + Intergenic
986192930 5:5513570-5513592 CCTCCCAGCCTTCATGCATGTGG + Intergenic
986239175 5:5941806-5941828 CCTCCCAGCCAGAAGCCAGGTGG - Intergenic
986261412 5:6150866-6150888 CCTCCTACCTTTAAGTCAACAGG - Intergenic
986911137 5:12558930-12558952 TCTCCCAGCCTGGAGTCCAGTGG + Intergenic
986960058 5:13200830-13200852 CCTTCCACCTTTAAGTCAAAAGG + Intergenic
987468021 5:18295703-18295725 CCTTCCACCTTTAAGTCAACAGG - Intergenic
988087566 5:26490882-26490904 CCTCCCTACGTTAAGTCAAATGG - Intergenic
988160598 5:27515211-27515233 CCTCCTACCTTTAAGTCAACAGG - Intergenic
988189002 5:27902897-27902919 CCTCCTACCTTTAAGTCAACAGG + Intergenic
988205073 5:28123693-28123715 CCTCCTACCTTTAAGTCAACAGG - Intergenic
988562359 5:32292493-32292515 CCTCCTACCTTTAAGTCAATAGG + Intronic
988785302 5:34561295-34561317 CCTCCTACCTTTAAGTCAACAGG - Intergenic
989044920 5:37265624-37265646 CCTCCTACCTTTAAGTCAACAGG - Intergenic
989307275 5:39972963-39972985 CCTCCTACCTTTAAGTCAACAGG - Intergenic
989486154 5:41994705-41994727 CCTCCCACCTTTAAGTCAATAGG - Intergenic
990354103 5:54948822-54948844 CTTCCCAGCCCTAAGTCCAGTGG + Intergenic
992243183 5:74791513-74791535 CCTCCTACCTTTAAGTCAACAGG + Intronic
993367114 5:87048206-87048228 CCTCCTACCTTTAAGTCAACAGG - Intergenic
995095547 5:108231686-108231708 CCTCCTACCTTTAAGTCAACAGG + Intronic
995776046 5:115726053-115726075 CCTCCTACCTTTAAGTCAACAGG - Intergenic
996018792 5:118569530-118569552 CCTCCCACCTCTAAGTCAACAGG + Intergenic
998153073 5:139768286-139768308 CCTCTCAGCCTGGAGTCCAGAGG - Intergenic
999236910 5:150104010-150104032 CCTCCCACCCCTAAGTCAGCAGG - Intronic
1002338781 5:178500563-178500585 CCTCCCAGCCTAGAGTACAGTGG - Intronic
1004399956 6:15279049-15279071 CCTCCCAGGCTGAAGTGCAGTGG - Intronic
1005185396 6:23158718-23158740 CCTCCTATCTTTAAGTCAATAGG + Intergenic
1006172352 6:32101036-32101058 CCTCTCAGGCTGAAGTGAAGTGG - Intronic
1008532249 6:52473740-52473762 CCACCCAGGCTGAAGTGAAGTGG - Intronic
1008820617 6:55626787-55626809 CCTCCTACCTTTCAGTCAAGAGG + Intergenic
1009040004 6:58164929-58164951 TCTCCCAGGCTGAAGTGAAGTGG + Intergenic
1009184985 6:60564284-60564306 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1009215898 6:60919778-60919800 TCTCCCAGGCTGAAGTGAAGTGG + Intergenic
1009389895 6:63133418-63133440 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1009851656 6:69207099-69207121 CCTCCTACCTTTAAGTCAACAGG - Intronic
1010291914 6:74147384-74147406 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1011039127 6:83011650-83011672 CCTCCTACCTTTAAGTCAACAGG - Intronic
1011830265 6:91363587-91363609 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1012344849 6:98172248-98172270 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1013459270 6:110359147-110359169 TCTCACAGCCTGAAGTCCAGTGG + Intergenic
1013623764 6:111917291-111917313 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1014414925 6:121172289-121172311 CCTCCTACCTTTAAGTCAACAGG + Intronic
1015443054 6:133270892-133270914 CCTCCTACCTTTAAGTCAACAGG - Intronic
1015475985 6:133659149-133659171 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1015871708 6:137782128-137782150 CCTCCCAGGCTTGAGTGCAGGGG + Intergenic
1016198316 6:141374643-141374665 CCACCCAGCCTGAAGTGCAGTGG + Intergenic
1016576041 6:145570928-145570950 CCTCCTACCTTTAAGTCAACAGG - Intronic
1016594792 6:145787131-145787153 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1017558825 6:155604889-155604911 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1018952149 6:168386206-168386228 CCTCCCAGCTGGAAGTCAACAGG + Intergenic
1019031836 6:169020194-169020216 CCTCCCAGATTCAAGTCCAGGGG - Intergenic
1019423927 7:964222-964244 TCTCCCAGGCTTAAGTGCAGTGG + Intronic
1020191467 7:6002067-6002089 TCTCCCAGTCTTAAGTGCAGTGG + Intronic
1020590514 7:10130864-10130886 CCTCCCAGGCTTGAGTGCAGTGG + Intergenic
1021692353 7:23242950-23242972 TCTCCTTGCCTTAAGTCCAGCGG - Intronic
1024040769 7:45551806-45551828 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1024884133 7:54123002-54123024 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1026023901 7:66730479-66730501 CCTCCTGGGCTTAAGTTAAGGGG + Intronic
1026821532 7:73552959-73552981 CCTCCCAGGCTGGAGTGAAGTGG + Intronic
1028044063 7:86093121-86093143 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1028934186 7:96446993-96447015 TCTCCCAGCCTGAAGTGCAGTGG - Intergenic
1028935247 7:96456725-96456747 CCTCCTACCTTTAAGTCAATGGG + Intergenic
1029374369 7:100168969-100168991 CCTCCCATCCTGAAGGCAGGGGG + Intergenic
1030355641 7:108539183-108539205 CCTCCTACCTTTAAGTCAACAGG + Intronic
1030368987 7:108675702-108675724 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1030457232 7:109791405-109791427 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1030559298 7:111064734-111064756 CCTCCTACCTTTAAGTCAACAGG + Intronic
1031833239 7:126651676-126651698 CCTCCTACCTTTAAGTCAACAGG + Intronic
1031861294 7:126983075-126983097 CCTCCTACCTTTAAGTCAACAGG - Intronic
1031861362 7:126983553-126983575 CCTCCTACCTTTAAGTCAACAGG + Intronic
1032152867 7:129445316-129445338 CCTCCTACCTTTAAGTCAACAGG - Intronic
1032308482 7:130759359-130759381 TCTCCCAGGCTGAAGTAAAGTGG + Intergenic
1032356220 7:131213355-131213377 CTTCACATCCTTAAGGCAAGAGG - Intronic
1033076488 7:138254674-138254696 CCTCCTATCTTTAAGTCAACAGG + Intergenic
1035415296 7:158678646-158678668 TCTCCCAGCCTGGAGTCCAGTGG - Intronic
1036495543 8:9266980-9267002 GATACCAGCCTTAACTCAAGAGG - Intergenic
1037937522 8:22925306-22925328 GCTCCCAGACTCGAGTCAAGGGG - Intronic
1039323959 8:36464892-36464914 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1040912166 8:52530069-52530091 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1041930773 8:63284297-63284319 CTTCCCAGCCTTTAGTACAGGGG + Intergenic
1044151018 8:88774730-88774752 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1044964124 8:97558419-97558441 CCACCTATCCTTAAGTCCAGGGG - Intergenic
1045149207 8:99384698-99384720 CCTCCCAGGCTGAAGTGCAGTGG + Intronic
1045222002 8:100208222-100208244 CCTCCTACCTTTAAGTCAACTGG + Intronic
1045824983 8:106386633-106386655 CCTCCAACCCCTAAGTCAAGGGG + Intronic
1046128421 8:109939714-109939736 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1046471647 8:114682681-114682703 CATCCCAGCCTTGGCTCAAGTGG - Intergenic
1047201511 8:122771461-122771483 TCTCCCAGCCTGGAGTGAAGTGG - Intergenic
1050482904 9:6104253-6104275 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1050596146 9:7206350-7206372 TCTCCCAGCCTGGAGTGAAGTGG + Intergenic
1050902056 9:10961570-10961592 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1052572150 9:30240674-30240696 TCTCGCTGCCTTAACTCAAGAGG - Intergenic
1053085745 9:35219329-35219351 TCTGCCAGCCATGAGTCAAGTGG - Intronic
1053471093 9:38346591-38346613 CCTCCGAGCCTTGGGTCATGTGG + Intergenic
1053791674 9:41690738-41690760 CCTCACAGCCTTCTGTCTAGTGG - Intergenic
1054153484 9:61624032-61624054 CCTCACAGCCTTCTGTCTAGTGG + Intergenic
1054180075 9:61902753-61902775 CCTCACAGCCTTCTGTCTAGTGG - Intergenic
1054473278 9:65555233-65555255 CCTCACAGCCTTCTGTCTAGTGG + Intergenic
1054657516 9:67678388-67678410 CCTCACAGCCTTCTGTCTAGTGG + Intergenic
1055103333 9:72487367-72487389 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1055289581 9:74768952-74768974 CCTCCAACCCTTAAGGAAAGGGG - Intronic
1058543952 9:106041098-106041120 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1058695417 9:107554811-107554833 CCTCCCAGGCTGAAGTGCAGTGG - Intergenic
1059358069 9:113716741-113716763 CCTCCCTGCCTTAATTCAACTGG - Intergenic
1059401621 9:114073989-114074011 CCTCCCACCCTTAACTCCAATGG + Intronic
1061825967 9:133258396-133258418 CCTCCCAGCCTTAAGTCAAGTGG - Intronic
1186469529 X:9810479-9810501 CCTCCTACCTTTAAGTCAACAGG - Intronic
1186552486 X:10521418-10521440 CCTCCAAGTCCTAAGTCAAGGGG - Intronic
1186612432 X:11151138-11151160 CCTCACATCCTTAAATCAAAGGG + Intronic
1188805081 X:34578124-34578146 CCACCCAGGCTGAAGTGAAGTGG - Intergenic
1189812799 X:44796835-44796857 TCACCCAGGCTTCAGTCAAGTGG + Intergenic
1190996382 X:55614488-55614510 CCTCCTATCTTTAAGTCAACAGG + Intergenic
1190996530 X:55615830-55615852 CCTCCTATCTTTAAGTCAACAGG - Intergenic
1191218775 X:57962933-57962955 CCTCCCAGGCTGGAGTGAAGTGG - Intergenic
1191759575 X:64631552-64631574 CCTCCTACCTTTAAGTCAAAAGG + Intergenic
1192297484 X:69866365-69866387 CCTCCTAATCTTAAGTCAACAGG - Intronic
1192891249 X:75393192-75393214 CCTCCTACCTTTAAGTCAACAGG - Intronic
1193428237 X:81367611-81367633 TCTCCCAGGCTGAAGTTAAGTGG + Intergenic
1193447391 X:81620421-81620443 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1193841329 X:86412112-86412134 CCTCCTACCTTTAAGTCAACAGG - Intronic
1194210508 X:91064002-91064024 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1194233077 X:91347938-91347960 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1194443750 X:93962745-93962767 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1194457176 X:94119131-94119153 CCTGCTACCCTTAAGTCAACAGG + Intergenic
1194513205 X:94820611-94820633 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1194604157 X:95960202-95960224 CCTCCTATCTTTAAGTCAACAGG - Intergenic
1194681315 X:96856997-96857019 TCTCCCAGCCTGAAGTGTAGTGG - Intronic
1194849025 X:98850515-98850537 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1196275850 X:113764338-113764360 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1196372450 X:114994927-114994949 CCTCCTACCTTTAAGTCAATAGG - Intergenic
1197182327 X:123549433-123549455 CCTCCTACCTTTAAGTCAAAAGG + Intergenic
1197244819 X:124157342-124157364 CCTCCTACCTTTAAGTCAACAGG - Intronic
1197420108 X:126227989-126228011 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1197477160 X:126939907-126939929 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1198307097 X:135394115-135394137 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1198412271 X:136382781-136382803 CCTCCTACCTTTAAGTCAATAGG - Intronic
1199024599 X:142921382-142921404 CCTCCTACCTTTAAGTCAACAGG + Intergenic
1199116348 X:143997613-143997635 CCTCCTACCTTTAAGTCAACAGG - Intergenic
1199190411 X:144963590-144963612 CCTCCCAGCCTAGAGACTAGGGG - Intergenic
1200657869 Y:5925567-5925589 TCTCCCAGCCAAAAGTCAGGAGG + Intergenic
1202186236 Y:22187236-22187258 CCACCCAGCCTGGAGTGAAGTGG + Intergenic
1202205123 Y:22399160-22399182 CCACCCAGCCTGGAGTGAAGTGG - Intronic