ID: 1061825978

View in Genome Browser
Species Human (GRCh38)
Location 9:133258445-133258467
Sequence CTGTGGGCAGAGAGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061825967_1061825978 26 Left 1061825967 9:133258396-133258418 CCACTTGACTTAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 366
Right 1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061825978 Original CRISPR CTGTGGGCAGAGAGGAGGCT GGG Intronic
No off target data available for this crispr