ID: 1061828128

View in Genome Browser
Species Human (GRCh38)
Location 9:133274656-133274678
Sequence GGCGCCTCGGGAAGGCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 644}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061828128_1061828143 25 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828143 9:133274704-133274726 TCCCGGTCAACCCGGGCGCCTGG No data
1061828128_1061828142 18 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828142 9:133274697-133274719 AGGCTGTTCCCGGTCAACCCGGG No data
1061828128_1061828140 8 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828140 9:133274687-133274709 TGGGGTATGGAGGCTGTTCCCGG No data
1061828128_1061828138 -2 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828138 9:133274677-133274699 CCTCCGCGTTTGGGGTATGGAGG No data
1061828128_1061828135 -10 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828135 9:133274669-133274691 CCGAGGCGCCTCCGCGTTTGGGG No data
1061828128_1061828136 -5 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828136 9:133274674-133274696 GCGCCTCCGCGTTTGGGGTATGG No data
1061828128_1061828141 17 Left 1061828128 9:133274656-133274678 CCACCTCGCCTTCCCGAGGCGCC 0: 1
1: 0
2: 3
3: 63
4: 644
Right 1061828141 9:133274696-133274718 GAGGCTGTTCCCGGTCAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061828128 Original CRISPR GGCGCCTCGGGAAGGCGAGG TGG (reversed) Intronic
900219471 1:1499839-1499861 GGCACTTCGGGAGGCCGAGGTGG - Intergenic
900917631 1:5649900-5649922 GGCACCTCGGAGAGACGAGGGGG + Intergenic
901227684 1:7623743-7623765 AGCACCTCGGGAGGCCGAGGCGG - Intronic
901276167 1:7992685-7992707 AGCACCTTGGGAAGCCGAGGTGG + Intergenic
901378046 1:8853864-8853886 GGCGCCTTGGGAGGCCGAGGCGG + Intergenic
901480323 1:9520604-9520626 GGTCCCTCTGGGAGGCGAGGAGG - Intergenic
901505450 1:9682483-9682505 GGCGCTTTGGGAGGCCGAGGTGG - Intronic
902476726 1:16692440-16692462 GGCGCGGCGGGGAGGCGCGGCGG + Intergenic
902516989 1:16994907-16994929 GGCACTTCGGGAGGCCGAGGCGG - Intronic
902558144 1:17259303-17259325 GGCACTTTGGGAAGCCGAGGCGG - Intronic
903353534 1:22732303-22732325 GGGGCCTGGGAAAGGTGAGGGGG + Intronic
903619422 1:24687088-24687110 GGCACCTTGGGAGGCCGAGGCGG - Intergenic
903648650 1:24910035-24910057 AGCGCTTTGGGAAGCCGAGGCGG + Intronic
903845922 1:26279994-26280016 GGCGGCGCGGGCAGGCGGGGTGG - Exonic
904045021 1:27603653-27603675 TGCGCGGCGGGAGGGCGAGGGGG - Intronic
904591547 1:31618043-31618065 GGGGCTCCGGGAAGGCGCGGGGG - Intronic
904738152 1:32651027-32651049 GTCGGCTCGGGGAGGCGTGGGGG + Intergenic
904761118 1:32804981-32805003 GGCACCTCGGGACGCCGAGGCGG + Intronic
904831772 1:33310052-33310074 GGCACCTCGGGAGGCCGAGGCGG + Intronic
904930180 1:34081665-34081687 GGCACCTCGGGAGGCCGAGGCGG - Intronic
905039908 1:34947674-34947696 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
905144576 1:35877936-35877958 AGCACTTTGGGAAGGCGAGGTGG - Intronic
905153369 1:35951196-35951218 AGCACTTCGGGAAGCCGAGGTGG - Intronic
905882161 1:41471248-41471270 AGCGACTCGGGAAGCTGAGGCGG - Intergenic
906097123 1:43231604-43231626 AGCACTTTGGGAAGGCGAGGTGG + Intronic
906160967 1:43649120-43649142 GGCACTTCTGGAGGGCGAGGGGG - Intergenic
907142322 1:52199308-52199330 AGCACTTCGGGAAGCCGAGGCGG - Intronic
908147356 1:61260825-61260847 AGCACCTCGGGAGGCCGAGGTGG - Intronic
909421843 1:75475935-75475957 AGCACTTCGGGAAGCCGAGGTGG + Intronic
909540595 1:76787489-76787511 AGCACTTCGGGAAGCCGAGGCGG - Intergenic
911016991 1:93344709-93344731 GGCTACTCTGGAGGGCGAGGTGG - Intergenic
912018691 1:105074817-105074839 AGCTACTCGGGAAGGTGAGGTGG + Intergenic
912331430 1:108823530-108823552 GGGGCCTCAGAAAGGCGAGTGGG - Intronic
912355645 1:109052897-109052919 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
912358302 1:109073612-109073634 GGCACCTCGGGAGGCCGAGGCGG - Intronic
912672780 1:111646784-111646806 GGCACTTTGGGAAGCCGAGGCGG - Intronic
913012577 1:114698713-114698735 AGCACTTCGGGAAGCCGAGGTGG - Intergenic
913332480 1:117678890-117678912 GGCGCCCCGGCAAGGGGAGGTGG + Intergenic
914142666 1:144964804-144964826 GGCTACTCGGGAAGCTGAGGTGG + Intronic
915201938 1:154236565-154236587 GGTGGCTCTGGTAGGCGAGGAGG + Exonic
915992489 1:160531653-160531675 AGCACCTCGGGAGGCCGAGGCGG - Intergenic
918172364 1:182010473-182010495 GGCACCTCGGGAGGCCCAGGTGG - Intergenic
918204742 1:182298894-182298916 GGCACTTTGGGAAGCCGAGGCGG + Intergenic
918417958 1:184331814-184331836 AGCGCTTTGGGAGGGCGAGGTGG + Intergenic
919404950 1:197167440-197167462 AGCGCTTTGGGAAGTCGAGGTGG - Intronic
920482225 1:206333637-206333659 GGCTACTCGGGAAGCTGAGGTGG - Intronic
920694830 1:208174353-208174375 GGCGCCTGGGGGAGGGAAGGAGG + Intronic
921109038 1:212014790-212014812 GGCACCTCGGGAGGCCCAGGCGG - Intronic
921138524 1:212284772-212284794 GGGGCCCGGGGAAGGCGAGAAGG - Intergenic
921192665 1:212724492-212724514 GGCACCTCGGGAGGCCGAGGTGG - Intergenic
921860281 1:220035950-220035972 GGCACTTCGGGAGGCCGAGGTGG + Intronic
922538791 1:226403423-226403445 AGCACTTCGGGAAGCCGAGGCGG - Intronic
922644771 1:227275849-227275871 GGCACCTCGGGAGGCCCAGGCGG - Intronic
922647508 1:227304157-227304179 GGCACTTTGGGAAGCCGAGGTGG + Intronic
923174773 1:231453801-231453823 GGCACCTCAGGAGGCCGAGGCGG - Intergenic
923372539 1:233327916-233327938 GGCGCCGGGGGAAGGCGAGGGGG - Exonic
923422692 1:233834206-233834228 AGCACTTCGGGAAGCCGAGGTGG - Intergenic
923699011 1:236282146-236282168 GAGGCCTCGGGGAGGCGGGGCGG - Intergenic
923806876 1:237267269-237267291 GGCGCTTTGGGAGGCCGAGGTGG + Intronic
923815583 1:237374272-237374294 GGCACCTTGGGAAGTGGAGGTGG + Intronic
924436489 1:244048395-244048417 GGCTCTTCGGGAAGGCGGAGGGG - Intergenic
924472786 1:244357828-244357850 GGCACTTTGGGAAGCCGAGGTGG + Intronic
924542607 1:244995469-244995491 TGCTACTCGGGAAGGTGAGGTGG - Intronic
924798166 1:247308100-247308122 GGCCCCTGGGAAAGGCAAGGAGG + Intronic
1063097717 10:2922917-2922939 GGCGCTTTGGGAAGCCGATGGGG + Intergenic
1063204287 10:3815932-3815954 GGGGCCTTTGGAAGGTGAGGAGG + Intergenic
1064100690 10:12461441-12461463 AGCACCTTGGGAAGCCGAGGTGG + Intronic
1064113775 10:12560303-12560325 AGCACTTTGGGAAGGCGAGGCGG + Intronic
1064231026 10:13529160-13529182 GGCGCCCCGAGGAGGCGCGGAGG + Intergenic
1064375575 10:14792577-14792599 GGCACTTTGGGAAGCCGAGGCGG + Intergenic
1064409100 10:15089822-15089844 TGTGCTTCGGGAAGCCGAGGTGG - Intergenic
1064768042 10:18695159-18695181 GGCGCTTTGGGAGGCCGAGGCGG - Intergenic
1065737940 10:28771415-28771437 GGCACCTCGGGAGGCCGAAGCGG - Intergenic
1065793330 10:29282001-29282023 GGCTACTCAGGAAGCCGAGGCGG - Intergenic
1065998243 10:31079827-31079849 AGCACTTCGGGAAGTCGAGGCGG + Intergenic
1066115349 10:32234022-32234044 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1066141353 10:32506602-32506624 AGCACCTCGGGAGGCCGAGGGGG + Intronic
1066325251 10:34352592-34352614 GGCACCTCGGGAGGCCCAGGTGG - Intronic
1067047544 10:42992983-42993005 GGCACCTCGGGAAGGCCTGGGGG - Intergenic
1067907200 10:50305017-50305039 GGCACTTTGGGAAGCCGAGGTGG - Intergenic
1068536152 10:58243615-58243637 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1069405542 10:68094507-68094529 AGCGCTTTGGGAAGCCGAGGTGG - Intergenic
1069803915 10:71105349-71105371 GGCACTTTGGGAAGCCGAGGCGG + Intergenic
1070575288 10:77672845-77672867 GGCCCCTGGGGAAGGCAGGGAGG - Intergenic
1071562228 10:86653228-86653250 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1072595995 10:96872443-96872465 GGCGCTTTGGGAGGCCGAGGTGG + Intronic
1073052958 10:100681123-100681145 GGGGCCTCGGGAAGGCCAGCCGG - Intergenic
1073281823 10:102360166-102360188 TGTGCCTGGGGAAGGCCAGGAGG - Exonic
1073469102 10:103711805-103711827 GGCACGTTGGGAAGCCGAGGCGG + Intronic
1073727799 10:106254444-106254466 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1074469491 10:113714494-113714516 AGCACCTCGGGAGGCCGAGGTGG + Intronic
1074786824 10:116849139-116849161 GGCGCGTGGGGAGGGCGGGGTGG + Intergenic
1075037620 10:119082213-119082235 GGCGCTTTGGGAGGCCGAGGCGG + Intergenic
1075366532 10:121895360-121895382 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1075384931 10:122048603-122048625 AGCACTTTGGGAAGGCGAGGTGG - Intronic
1075389802 10:122084094-122084116 GGTGCCTTGGGAAGAGGAGGGGG - Exonic
1075448242 10:122528826-122528848 GGGGCCTTGGGAAGGAGAAGAGG - Intergenic
1075719130 10:124574800-124574822 GAGGCCTCAGGAAGACGAGGAGG - Intronic
1075893035 10:125970563-125970585 GGCGCCTCGGGAGGCCGAGGTGG + Intronic
1076692313 10:132230135-132230157 GCCGCCTTGGGAGGGCGGGGCGG + Intronic
1076901754 10:133342594-133342616 AGCGCTTTGGGAAGCCGAGGCGG - Intronic
1077114450 11:877019-877041 GGCACTTCGGGTGGGCGAGGAGG + Intronic
1077326736 11:1967250-1967272 GGGGCCTCTGGAGGGTGAGGAGG - Intronic
1077396880 11:2328627-2328649 GGGGCCTTTGGAAGGCGATGAGG - Intergenic
1077680651 11:4237418-4237440 GGCACCTTGGGAGGCCGAGGCGG - Intergenic
1077684932 11:4282816-4282838 GGCACCTTGGGAGGCCGAGGCGG - Intergenic
1077690258 11:4335114-4335136 GGCACCTTGGGAGGCCGAGGCGG + Intergenic
1078246236 11:9574608-9574630 GGCGGCGCAGGAAAGCGAGGGGG - Intronic
1080538273 11:33243333-33243355 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
1081555164 11:44152596-44152618 AGCACTTTGGGAAGGCGAGGAGG - Intronic
1081981677 11:47270423-47270445 GGCGCCCCGGGCAGAGGAGGGGG + Intronic
1083037976 11:59657914-59657936 AGCGCCTTGGGAGGGTGAGGTGG + Intronic
1083338267 11:61940673-61940695 AGCACTTCGGGAAGACGAGGTGG + Intergenic
1083604150 11:63967490-63967512 AGCACTTCGGGAGGGCGAGGTGG + Intergenic
1083674690 11:64318854-64318876 AGCACTTCGGGAAGCCGAGGCGG - Intronic
1084059588 11:66661780-66661802 GGCACTTTGGGAAGCCGAGGTGG + Intronic
1084148159 11:67275833-67275855 GAAGCCTTGGGAAGGAGAGGAGG - Intronic
1084214797 11:67641466-67641488 GGCGCCTCGGGCAGGCAGGGCGG - Intergenic
1085159558 11:74328052-74328074 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
1085205894 11:74731615-74731637 GGCGCCGAGTGGAGGCGAGGGGG + Intergenic
1085626908 11:78080645-78080667 GGCTGCTCGGGAAGCTGAGGGGG + Intergenic
1087475437 11:98627728-98627750 GGCGCTTTGGGATGCCGAGGTGG - Intergenic
1088315144 11:108499075-108499097 GGCACTTTGGGAAGCCGAGGCGG - Intergenic
1088634633 11:111807955-111807977 GGTGCCTTGGGAAGCTGAGGTGG + Intronic
1088897774 11:114091099-114091121 GGCACTTCGGGAGGCCGAGGTGG + Intronic
1089496563 11:118911179-118911201 GGCGGGTAGGGGAGGCGAGGGGG - Intronic
1090442728 11:126737443-126737465 GGGGCCTGGGGAAGGAGTGGAGG + Intronic
1090743814 11:129691425-129691447 GGTGCCTCTGGAAGGAGAGCTGG - Intergenic
1091124315 11:133082280-133082302 GGGGCCTTGGGTAGGCGAGCCGG + Intronic
1202809717 11_KI270721v1_random:22430-22452 GGGGCCTCTGGAGGGTGAGGAGG - Intergenic
1091437038 12:481077-481099 GACGCTGAGGGAAGGCGAGGTGG + Intronic
1092837457 12:12504372-12504394 GGCTACTCGGGAAGCTGAGGTGG - Intronic
1092850120 12:12618779-12618801 GGCACCTCGGGAGGCCCAGGCGG + Intronic
1092864281 12:12746246-12746268 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1093175187 12:15905449-15905471 AGCACTTCGGGAAGCCGAGGCGG - Intergenic
1093958370 12:25248335-25248357 GGCTACTCGGGAAGCTGAGGCGG + Intronic
1094585707 12:31775659-31775681 AGCTCCTCGGGAAGCTGAGGTGG - Intergenic
1094587047 12:31787123-31787145 AGCGTCTTGGGAAGCCGAGGAGG + Intergenic
1094605601 12:31946424-31946446 AGCACCTCGGGAGGTCGAGGTGG + Intergenic
1095218275 12:39576404-39576426 AGCACTTCGGGAGGGCGAGGCGG - Intronic
1095452952 12:42350713-42350735 GGCACCTCGGGAGGCTGAGGCGG + Intronic
1095773911 12:45991447-45991469 AGCTCCTCGGGAAGATGAGGTGG + Intronic
1095774768 12:45999906-45999928 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
1096054687 12:48641611-48641633 AGCACCTCGGGAGGCCGAGGCGG - Intergenic
1096153326 12:49328468-49328490 AGCACTTCGGGAAGCCGAGGAGG - Intronic
1096737964 12:53670868-53670890 AGCACCTTGGGAAGCCGAGGTGG - Intronic
1096828098 12:54294708-54294730 GGGGCCTCAGGAAGGGGAGTCGG - Intronic
1096848337 12:54419725-54419747 GGCGGCCCCGGAAGGCAAGGGGG - Intergenic
1097089715 12:56495112-56495134 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1097241532 12:57578814-57578836 AGCGCTTCAGGAAGCCGAGGCGG + Intronic
1097245884 12:57607311-57607333 GCCTCCTCCCGAAGGCGAGGAGG - Exonic
1098379657 12:69854095-69854117 GGCACCTCGGGAGGCCGAGGCGG + Intronic
1098941023 12:76536237-76536259 AGCGCTTTGGGAAGGCGAGTCGG + Intronic
1100633050 12:96407440-96407462 AGCACCTTGGGAAGCCGAGGTGG + Intergenic
1100667923 12:96775180-96775202 GACGCTTTGGGAAGCCGAGGTGG + Intronic
1101920823 12:108931584-108931606 AGCACCTCGGGAGGCCGAGGTGG + Intronic
1102099132 12:110264254-110264276 AGTGCTTTGGGAAGGCGAGGCGG + Intergenic
1102339242 12:112108675-112108697 GGCGCGTCGGGCTGGCGAGCGGG + Intronic
1102656390 12:114485364-114485386 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1103005015 12:117414124-117414146 AGCGCCTTGGGAGGCCGAGGTGG + Intronic
1103045276 12:117730755-117730777 GGCACCTCGGGAGGCCGAGGCGG - Intronic
1103116666 12:118339779-118339801 AGCGCTTTGGGAAGCCGAGGCGG - Intronic
1103267887 12:119646304-119646326 GGCACTTTGGGAAGCCGAGGTGG - Intergenic
1103796350 12:123505870-123505892 GGCCCTTCGGGAGGCCGAGGTGG - Intronic
1104339539 12:127935134-127935156 GGCTCCTCGGGAGGCTGAGGTGG - Intergenic
1104553350 12:129777884-129777906 AGCACTTCGGGAAGCCGAGGTGG + Intronic
1104970333 12:132528048-132528070 GGGGCCTCGGACAGGTGAGGTGG - Intronic
1105364416 13:19751808-19751830 AGCGCTTCGGGAGGCCGAGGCGG + Intronic
1105926572 13:25014143-25014165 AGCACCTCGGGAGGCCGAGGTGG - Intergenic
1106222845 13:27761094-27761116 GGCATCTCGGCAAGGCGTGGTGG - Intergenic
1106252755 13:27995359-27995381 AGCACCTTGGGAAGCCGAGGTGG + Intergenic
1106278918 13:28245092-28245114 GGCGCTTTGGGAGGCCGAGGTGG - Intronic
1106615658 13:31324952-31324974 GGCACTTTGGGAAGTCGAGGTGG - Intronic
1106747817 13:32722105-32722127 GGCACCTTGGGAGGCCGAGGCGG + Intronic
1107922963 13:45229128-45229150 GGCACTTCGGGAGGCCGAGGTGG - Intronic
1111230729 13:85341255-85341277 GGCACCTCGGGAGGCCGAGGTGG + Intergenic
1111915733 13:94358040-94358062 GGCACTTTGGGAAGCCGAGGAGG + Intronic
1112511814 13:100016408-100016430 GGCACTTTGGGAAGCCGAGGCGG + Intergenic
1112515357 13:100048672-100048694 GGCACCTTGGGAGGCCGAGGTGG - Intergenic
1112547579 13:100386626-100386648 AGCACCTTGGGAAGCCGAGGCGG - Intronic
1112689188 13:101870704-101870726 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1113009411 13:105746881-105746903 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1113087269 13:106581319-106581341 GCCGGCTTGGGAAGGGGAGGTGG + Intergenic
1113329008 13:109311145-109311167 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
1113735869 13:112678791-112678813 GGCACTTCGGGAGGCCGAGGCGG + Intronic
1114168899 14:20251019-20251041 GGCTACTCGGGAAGCTGAGGTGG - Intergenic
1114305451 14:21419309-21419331 AGCGCTTCGGGAGGCCGAGGCGG + Intronic
1114496270 14:23135012-23135034 GGTGCTTTGGGAAGGCAAGGTGG - Intronic
1114578641 14:23736576-23736598 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
1114594428 14:23898953-23898975 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1115369460 14:32595619-32595641 GGCTACTCGGGAAGCTGAGGCGG - Intronic
1115548902 14:34487859-34487881 GGTGCGTCGGCCAGGCGAGGTGG - Intergenic
1115556443 14:34548138-34548160 AGCGCCTTGGGAGGCCGAGGTGG + Intergenic
1115778164 14:36739428-36739450 AGCACTTCGGGAAGCCGAGGTGG + Intronic
1116250287 14:42473510-42473532 GGCGCTTTGGGAGGCCGAGGCGG + Intergenic
1116959744 14:50956981-50957003 GGCACCTCGGGAGGCTGAGGCGG + Intergenic
1117125873 14:52625234-52625256 AGGGCTTCGGGAAGCCGAGGCGG + Intronic
1117803002 14:59464461-59464483 GGCGCCCCGGGAACTCGCGGCGG - Exonic
1117972610 14:61266847-61266869 GGCGCCTAGGGAGGGAGATGAGG + Intronic
1118156122 14:63243585-63243607 GGCACTTCGGGAAGCCAAGGTGG - Intronic
1118194189 14:63609539-63609561 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1119051949 14:71377725-71377747 GGCACCTCGGGAGGCCGAGGCGG + Intronic
1119600617 14:75973892-75973914 AGCACTTCGGGAAGCCGAGGTGG + Intronic
1119611375 14:76065865-76065887 GGCACTTCGGGAAACCGAGGTGG - Intronic
1122290629 14:100678591-100678613 GGCTCCTCGGGAAGGGGGGTGGG + Intergenic
1122547952 14:102535110-102535132 AGCACTTCGGGAAGCCGAGGCGG + Intergenic
1122727326 14:103766253-103766275 AGCACCTTGGGAAGCCGAGGTGG - Intronic
1123430970 15:20216002-20216024 GGAGTCTTGGGCAGGCGAGGGGG + Intergenic
1124102952 15:26712757-26712779 GCCACCTCGGGAAGGTGGGGAGG + Intronic
1124906905 15:33877565-33877587 AGCACTTCGGGAAGCCGAGGAGG + Intronic
1126036356 15:44549520-44549542 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1126151048 15:45523801-45523823 GGCCCTTTGGGAAGCCGAGGCGG + Intergenic
1126591891 15:50348365-50348387 GGCTACTCGGGAGGCCGAGGTGG - Intronic
1126632579 15:50752468-50752490 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1126752038 15:51886415-51886437 GGCACCTCGGGAGGCCGAGGCGG + Intronic
1126766994 15:52019416-52019438 GGCGGCTCGGGAGGGCGCCGCGG + Intronic
1127023935 15:54781845-54781867 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1127088883 15:55447524-55447546 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1127094136 15:55495977-55495999 GGCACTTCGGGAGGCCGAGGTGG + Intronic
1128030954 15:64479669-64479691 AGCGCTTTGGGAAGCCGAGGTGG + Intronic
1128500023 15:68221477-68221499 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1128601161 15:68996597-68996619 GGCACTTTGGGAAGCCGAGGCGG + Intronic
1129536755 15:76319384-76319406 AGCTACTCGGGAAGGTGAGGTGG + Intergenic
1129589096 15:76899409-76899431 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1130330026 15:82914934-82914956 AGCGCCTTGGGAAGCCGAAGTGG + Intronic
1130760752 15:86817037-86817059 GGCGCTTTGGGAAGCTGAGGTGG + Intronic
1130942569 15:88523686-88523708 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1131170142 15:90172232-90172254 GGCTACTCGGGAGGGTGAGGTGG + Intronic
1131587728 15:93714448-93714470 AGCACTTCGGGAAGCCGAGGCGG - Intergenic
1131741065 15:95392217-95392239 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1131826105 15:96323337-96323359 TGCGCCCGGGGAAGGCCAGGAGG - Intergenic
1132670867 16:1101874-1101896 GGTGCCCCGGGAAGGCTGGGTGG - Intergenic
1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG + Intronic
1133048379 16:3101940-3101962 GGCGCTTTGGGAGGCCGAGGCGG - Intergenic
1133174623 16:4004800-4004822 GGAGGCACGGGAAGGCGTGGTGG + Intronic
1133299805 16:4775419-4775441 GTTGCCTGGGGAAGGCAAGGAGG + Intergenic
1134230127 16:12422551-12422573 GGAGCCCAGGGAAGACGAGGAGG - Intronic
1134995197 16:18734008-18734030 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
1135549569 16:23387858-23387880 GGCGGCTGGGGCAGGAGAGGAGG - Intergenic
1135629942 16:24028334-24028356 AGCACTTCGGGAAGCCGAGGTGG - Intronic
1135694646 16:24575511-24575533 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1136378083 16:29877155-29877177 GGGGCCTTGGGAGGCCGAGGCGG - Intronic
1136576261 16:31127122-31127144 GGCTCCTCGGCAAGGGGAGACGG - Intronic
1136853684 16:33635245-33635267 GGAGTCTTGGGCAGGCGAGGGGG - Intergenic
1137250883 16:46740048-46740070 GGAGCCTGGGGAAGGTGAGTGGG - Exonic
1137430915 16:48417252-48417274 GGCACCTCAGGAGGCCGAGGCGG + Intronic
1137439167 16:48483595-48483617 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1139868356 16:70082330-70082352 GGCACCTTGGGAAGCCGAGGGGG + Intergenic
1139944329 16:70628898-70628920 AGCTCCTCGGGAGGCCGAGGTGG - Intronic
1140386978 16:74549531-74549553 GGCACCTTGGGAAGCTGAGGCGG - Intronic
1140396259 16:74629409-74629431 AGCACTTCGGGAAGCCGAGGTGG + Intronic
1141155748 16:81595634-81595656 GGCACTTTGGGAAGCCGAGGTGG - Intronic
1141305228 16:82856452-82856474 GGCACTTTGGGAAGTCGAGGTGG + Intronic
1141469212 16:84227327-84227349 GGCACTTTGGGAAGCCGAGGCGG + Intronic
1141484000 16:84326709-84326731 GGGGCCTGGGGAGGGAGAGGAGG + Intronic
1141519979 16:84572070-84572092 GGAGCCGCTGGAAGGCGTGGAGG - Intronic
1141661187 16:85442485-85442507 GGAGCCTCGGGCAGGCTAGAGGG + Intergenic
1142018686 16:87766328-87766350 AGCTCCTCGGGAAGGTGAGGCGG + Intergenic
1142416956 16:89948508-89948530 AGCGCTTCGGGAGGCCGAGGCGG - Intronic
1203115275 16_KI270728v1_random:1483690-1483712 GGAGTCTTGGGCAGGCGAGGGGG - Intergenic
1142475898 17:189765-189787 AGCGCTTCGGGAAGCCAAGGTGG + Intergenic
1142583408 17:955647-955669 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1142665678 17:1462219-1462241 GGCGCTTTGGGAGGCCGAGGTGG - Intronic
1142732217 17:1867596-1867618 GGCTACTCGGGAAGTCGAGGTGG + Intronic
1143098884 17:4493945-4493967 AGCACTTCGGGAAGCCGAGGCGG - Intergenic
1143409180 17:6698194-6698216 GGCCCGTCGGGAAGGGGAAGGGG + Intronic
1143555926 17:7660244-7660266 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
1144008875 17:11126405-11126427 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1144183950 17:12778472-12778494 GGCACTTTGGGAAGCCGAGGCGG - Intergenic
1144878659 17:18419053-18419075 GGCTCCTCGGGAGGCTGAGGCGG - Intergenic
1144967776 17:19088979-19089001 GACGGGGCGGGAAGGCGAGGCGG - Intergenic
1144980140 17:19163084-19163106 GACGGGGCGGGAAGGCGAGGCGG + Intergenic
1144988082 17:19215148-19215170 GACGGGGCGGGAAGGCGAGGCGG - Intergenic
1145153578 17:20525342-20525364 GGCTCCTCGGGAGGCTGAGGCGG + Intergenic
1145886298 17:28384641-28384663 GGCGCCGCGGGATTGCGAGGCGG - Intronic
1146354725 17:32124520-32124542 AGCGCTTTGGGAAGCCGAGGTGG - Intergenic
1146852382 17:36233819-36233841 GGCACTTTGGGAAGCCGAGGTGG + Intronic
1146868290 17:36357691-36357713 GGCACTTTGGGAAGCCGAGGTGG + Intronic
1147071165 17:37958312-37958334 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1147082691 17:38037838-38037860 GGCACTTTGGGAAGCCGAGGTGG + Intronic
1147098635 17:38161807-38161829 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1147208441 17:38856124-38856146 AGCGCCTTGGGAGGCCGAGGCGG + Intergenic
1147283458 17:39381847-39381869 AGCACTTCGGGAAGCCGAGGGGG + Intronic
1147311518 17:39598747-39598769 GGCGCGGGGGGAAGGCGGGGAGG - Intergenic
1147375109 17:40018558-40018580 GGAGCCACGGGCAGGGGAGGTGG - Intergenic
1147859564 17:43510293-43510315 GGCGCTTTGGGAGGCCGAGGGGG - Intronic
1148672353 17:49420192-49420214 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1148701873 17:49592468-49592490 GGAGCCTAGGGCAGGCCAGGTGG - Intergenic
1149149773 17:53547313-53547335 GGTACCTTGGGAAGCCGAGGCGG - Intergenic
1149582192 17:57758347-57758369 AGCACCTTGGGAAGCCGAGGTGG + Intergenic
1149634663 17:58157076-58157098 GGGGCCTGGGGACGCCGAGGCGG + Intergenic
1150047628 17:61928808-61928830 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
1150080174 17:62230836-62230858 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1150892020 17:69163082-69163104 AGCGCTTTGGGAAGCCGAGGTGG - Intronic
1151200520 17:72464544-72464566 AGCGCTTCGGGAGGCCGAGGCGG - Intergenic
1151281101 17:73074542-73074564 GGCACTTTGGGAAGCCGAGGTGG - Intronic
1151306344 17:73264928-73264950 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1151493512 17:74446203-74446225 GGCACTTTGGGAAGCCGAGGCGG + Intronic
1151728914 17:75899596-75899618 GGAGCCTCGGGCAGGGAAGGGGG + Exonic
1151765765 17:76132550-76132572 GGCACCTCGGGCAGGGGAGGGGG - Intergenic
1151944193 17:77310644-77310666 GGCCACTCGGGAGGGCGTGGTGG - Intronic
1152170704 17:78745644-78745666 GGCGCTTTGGGAGGCCGAGGCGG + Intronic
1152217361 17:79041528-79041550 AGCACCTCGGGAGGCCGAGGTGG + Intronic
1152343356 17:79737450-79737472 GGCGGCACGAGAGGGCGAGGGGG + Intronic
1152749877 17:82057706-82057728 GGCGCCTAGGGGAGGTGGGGAGG + Intronic
1152824262 17:82454173-82454195 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1153029772 18:702625-702647 AGCTACTCGGGAAGGTGAGGTGG + Intronic
1153040873 18:812204-812226 GGCGCCCCGGGACGAGGAGGTGG - Intronic
1153580877 18:6572117-6572139 GGCACCCTGGGAAGCCGAGGAGG + Intronic
1153891384 18:9519088-9519110 GGCACTTTGGGAAGCCGAGGTGG + Intronic
1154486044 18:14871775-14871797 AGCTACTCGGGAAGCCGAGGTGG + Intergenic
1157897424 18:51482428-51482450 AGCACCTTGGGAAGCCGAGGCGG - Intergenic
1157929291 18:51803441-51803463 AGCACTTTGGGAAGGCGAGGCGG + Intergenic
1159102340 18:63970596-63970618 GGAGCCCCGGGAGGGCGAGTGGG + Intronic
1159482877 18:69013363-69013385 GGCGACTCGGAAAGGTGGGGTGG + Intronic
1160708736 19:541136-541158 GGGGGCTCGGGAAGGGCAGGAGG - Intronic
1160719384 19:590649-590671 AGCGCCTGGGGAGGGCGGGGCGG + Intronic
1160726794 19:620976-620998 GGCGCCGGGGGAGGGCGCGGGGG + Intronic
1160726805 19:620997-621019 GGCGCCGGGGGAGGGCGCGGGGG + Intronic
1160734199 19:654393-654415 GGCACTTCGGGAGGCCGAGGCGG + Intronic
1160823869 19:1070592-1070614 GGCGCTTTGGGAGGCCGAGGTGG - Intronic
1161186012 19:2921227-2921249 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
1161239245 19:3212869-3212891 GGCACTTCGGGAGGCCGAGGCGG - Intergenic
1161265008 19:3359933-3359955 GGCGCCGCGAGTTGGCGAGGAGG + Intronic
1161269261 19:3380899-3380921 AGCGCTTCGGGAGGCCGAGGAGG - Intronic
1161364481 19:3870200-3870222 AGCACTTTGGGAAGGCGAGGTGG + Intergenic
1161448112 19:4329210-4329232 AGCACCTTGGGAAGCCGAGGCGG - Intronic
1161520836 19:4722873-4722895 GGCCCCTGGGGAAGACCAGGGGG + Intronic
1161556292 19:4944557-4944579 GGTGCCTCGGCTAGCCGAGGAGG + Intronic
1161584647 19:5098664-5098686 GGGGCCTCTGGGAGGCGACGAGG + Intronic
1161963627 19:7535869-7535891 GGCGCCCGGGGAAGGCTCGGCGG + Exonic
1161972251 19:7589035-7589057 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1162312069 19:9913702-9913724 GGCGCCCCGGGGGGGCGTGGGGG + Intronic
1162602247 19:11677625-11677647 GGCACCTCGGGAGGCCAAGGCGG + Intergenic
1162914622 19:13867510-13867532 GGCGCTCTGGGAAGCCGAGGTGG - Intronic
1163015562 19:14451926-14451948 GGCGGCTCAGGAAGGGGGGGCGG - Exonic
1163051838 19:14690160-14690182 GGCCCCTCGGGAGGGCGGGGAGG + Intronic
1163125943 19:15244284-15244306 GGCGGCTGGGGCAGGTGAGGGGG + Exonic
1163160519 19:15461439-15461461 GGCACCTGGGAAAGGGGAGGAGG - Intronic
1163205430 19:15799002-15799024 GGCACCTTGGGAGGCCGAGGTGG - Intergenic
1163616813 19:18334085-18334107 AGCGCTTTGGGAAGGTGAGGTGG - Intergenic
1163725093 19:18918674-18918696 GGCGCTTTGGGAGGCCGAGGCGG - Intronic
1163729568 19:18941262-18941284 GGCGGCCCGGGGAGGCGGGGCGG - Intergenic
1164016903 19:21261526-21261548 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1164188093 19:22889760-22889782 AGCTCCTCGGGAAGCTGAGGTGG + Intergenic
1164615976 19:29666934-29666956 GGCCCCTCTGGAGGGAGAGGAGG + Intronic
1165325582 19:35112555-35112577 TGCGCTTCGGGAAGCCAAGGTGG + Intergenic
1165400238 19:35594946-35594968 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1165978535 19:39699118-39699140 GGCACTTTGGGAAGCCGAGGTGG - Intergenic
1166154619 19:40901573-40901595 GGCACTTCGGGAGGCCGAGGTGG + Intergenic
1166302631 19:41921144-41921166 GGCGCCACCGTGAGGCGAGGCGG + Intronic
1166307032 19:41940824-41940846 GGGGATCCGGGAAGGCGAGGGGG + Intergenic
1166700916 19:44881153-44881175 AGCGCTTTGGGAGGGCGAGGCGG - Intronic
1166809444 19:45506925-45506947 CCCGCCCCGGGAAGGTGAGGAGG - Intronic
1166884241 19:45949986-45950008 AGCACCTTGGGAAGCCGAGGTGG - Intronic
1167107200 19:47437308-47437330 GGCGCTTTGGGAGGGTGAGGCGG - Intronic
1167128363 19:47567505-47567527 AGCGCTTTGGGAAGCCGAGGAGG - Intergenic
1167345130 19:48940741-48940763 GGCTACTCTGGAAGGTGAGGTGG + Intronic
1167405565 19:49305477-49305499 AGCTACTCGGGAAGGTGAGGCGG + Intronic
1167588826 19:50391446-50391468 GGCACCTCGGGAGGCCCAGGCGG + Intronic
1167605050 19:50477153-50477175 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1167913379 19:52721429-52721451 GGCACCTCGGGAGGCCAAGGCGG + Intronic
1168068772 19:53937135-53937157 CGCACCTCGGGAGGCCGAGGTGG - Intronic
1168193059 19:54754292-54754314 AGCACGTCGGGAAGCCGAGGTGG - Intronic
1168221948 19:54966771-54966793 GGCACCTTGGGAGGCCGAGGCGG - Intronic
1168288352 19:55345475-55345497 GGGGTCTCGGGGAGGCGAGGAGG + Intronic
1168718965 19:58544548-58544570 GGCGCCTTCGGGAGGCGAGCAGG + Exonic
1168723079 19:58565475-58565497 AGCACTTTGGGAAGGCGAGGCGG - Intronic
924962544 2:46798-46820 AGCGCCGCCGGAAGGTGAGGGGG - Intronic
925163306 2:1701769-1701791 GGGGCCTCTGGGAGGTGAGGAGG + Intronic
925406455 2:3608573-3608595 GGCACTTTGGGAAGCCGAGGTGG + Intronic
926095609 2:10079594-10079616 GGCGGCCCGGGAAGGCCAGGCGG + Intronic
926249140 2:11143704-11143726 GGCACCTGGGGAAGGGGAAGTGG + Intronic
927737643 2:25536452-25536474 AGCACCTCGGGAGGCCGAGGCGG + Intronic
928141714 2:28735052-28735074 GGCTACTCGGGAAGCTGAGGTGG + Intergenic
928222828 2:29419299-29419321 AGCGCTTTGGGAAGCCGAGGTGG - Intronic
928445397 2:31329435-31329457 GGCAGCTCCAGAAGGCGAGGGGG - Intergenic
928508425 2:31978543-31978565 AGCTACTCGGGAAGCCGAGGTGG - Intronic
928934977 2:36666713-36666735 AGCTACTCGGGAAGGTGAGGTGG - Intergenic
929298386 2:40273338-40273360 AGCGCTTTGGGAAGCCGAGGCGG - Intronic
929658811 2:43761656-43761678 AGCACCTTGGGAAGCCGAGGTGG - Intronic
929855640 2:45636640-45636662 GGCACCTCAGGAGGCCGAGGTGG + Intergenic
929936129 2:46296065-46296087 GGAGCCTGGAGAAGGCGAAGTGG - Intronic
932683370 2:73846832-73846854 AGCGCTTCGGGAGGCCGAGGTGG + Intronic
933763118 2:85687659-85687681 AGCACTTCGGGAGGGCGAGGTGG + Intronic
935645714 2:105332355-105332377 AGCACCTTGGGAAGCCGAGGTGG - Intergenic
936125512 2:109786292-109786314 AGCCCCTCGGGGAGGTGAGGTGG - Intergenic
936219181 2:110585176-110585198 AGCCCCTCGGGGAGGTGAGGTGG + Intergenic
936708395 2:115102654-115102676 GGCACCTTGGGAGGCCGAGGCGG - Intronic
936923751 2:117715619-117715641 AGCACGTCGGGAGGGCGAGGTGG + Intergenic
938120722 2:128631349-128631371 GGCTCCTCAGGAAGGAGAGTGGG + Intergenic
938253317 2:129833267-129833289 GGCACCTCGGGAGGCCCAGGCGG - Intergenic
938807386 2:134818914-134818936 GGCTACTCGGGAAGGTGAGGTGG + Intergenic
939028844 2:137046480-137046502 AGCACTTTGGGAAGGCGAGGTGG + Intronic
939621337 2:144422550-144422572 GGCACTTCGGGAGGCCGAGGTGG + Intronic
939629490 2:144516253-144516275 GGCGCCTGGGGGAGGGGAGAGGG - Intronic
940817406 2:158311220-158311242 GGCACCTCGGGAGGCCGAGGTGG + Intronic
941778798 2:169422277-169422299 AGCTCCTGGGGAAGGTGAGGTGG - Intergenic
942477186 2:176339690-176339712 GGAGCCTTGGGAGGCCGAGGTGG - Intergenic
944193123 2:197024397-197024419 AGTGCCTCGGGAAGGTGAGCTGG + Intronic
944793644 2:203160326-203160348 GGCACTTTGGGAAGCCGAGGCGG - Intronic
945223412 2:207507416-207507438 GGCACTTTGGGAAGCCGAGGCGG + Intergenic
945465989 2:210171235-210171257 GGCGCCCCGGGTGGGGGAGGCGG - Exonic
945559205 2:211317212-211317234 AGCTACTTGGGAAGGCGAGGTGG + Intergenic
946024063 2:216661349-216661371 AGCGCTTCGGGAGGCCGAGGTGG - Intronic
946431733 2:219629986-219630008 GGAGCCACGGGATGGGGAGGGGG + Intronic
946954336 2:224912380-224912402 AGCACCTTGGGAAGCCGAGGCGG - Intronic
947805967 2:232968333-232968355 GGCACTTTGGGAAGCCGAGGTGG - Intronic
948047093 2:234952592-234952614 GGGGCCACGGGAGGGCGTGGAGG + Intronic
948586074 2:239020633-239020655 GGCGCGTCGGGGAGGCCAGTTGG + Intergenic
948748235 2:240110880-240110902 GGAGCCTGAGGAAGGTGAGGAGG - Intergenic
948946034 2:241219678-241219700 GGCTTCTCGGGAAGCTGAGGTGG - Intronic
949013759 2:241697667-241697689 GGGGCCTCGGGAGGGGGAGAGGG + Intergenic
1168801301 20:645120-645142 AGTGCCTCGGGAGGCCGAGGCGG + Intergenic
1169420048 20:5452546-5452568 GGCACCCCGGGAGGCCGAGGCGG - Intergenic
1170610132 20:17906153-17906175 GGAGCCTGGGGAAGGAGAGTGGG + Intergenic
1170689542 20:18601250-18601272 AGCGCTTTGGGAAGCCGAGGAGG + Intronic
1171164394 20:22957484-22957506 AGGGCCTCGGGAAGGCAATGAGG + Intergenic
1171452813 20:25247982-25248004 GGGGCCTCGGGAGGGCGGGGCGG - Intergenic
1172002973 20:31795066-31795088 AGCACTTCGGGAAGCCGAGGCGG - Intronic
1172318247 20:33973660-33973682 CGCACCTCGGGAGGCCGAGGCGG - Intergenic
1172404441 20:34677107-34677129 GGCGGGGAGGGAAGGCGAGGCGG + Intergenic
1172738898 20:37150534-37150556 GGCACCTCGGGAGGCCGAGGCGG - Intronic
1173473118 20:43338778-43338800 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1173550502 20:43929953-43929975 AGCGCTTCGGGAGGCCGAGGCGG - Intronic
1173649376 20:44653238-44653260 CACGCCTTGGGAAGCCGAGGTGG - Intergenic
1174656860 20:52178894-52178916 AGCCCCTCGGGGAGGGGAGGAGG - Intronic
1175286689 20:57841338-57841360 GGCCCCTCGGGCAGGCGGAGGGG - Intergenic
1175715781 20:61253278-61253300 GGCGCCCCGGGAGGGCGAGCGGG + Intronic
1175809761 20:61851709-61851731 GGCGCTGCCGGCAGGCGAGGGGG - Intronic
1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG + Intronic
1176101277 20:63365665-63365687 GGGTCCACGGGAGGGCGAGGAGG - Intronic
1176795261 21:13367603-13367625 AGCTACTCGGGAAGCCGAGGTGG - Intergenic
1177625399 21:23653367-23653389 AGCACTTCGGGAAGCCGAGGCGG + Intergenic
1177739234 21:25133903-25133925 GGCGTCTCTGGAAGGAGAGTTGG + Intergenic
1178308417 21:31509579-31509601 CGTGCCTCGGGAAGGAGATGAGG - Intronic
1178518793 21:33269903-33269925 AGCACTTCGGGAAGCCGAGGTGG - Intronic
1179167374 21:38945249-38945271 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1179665596 21:42910076-42910098 AGCGCTTTGGGAGGGCGAGGCGG + Intronic
1179814710 21:43897889-43897911 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1180086319 21:45509479-45509501 TGGGGCTCGGGCAGGCGAGGGGG - Exonic
1180200278 21:46219927-46219949 TGCGCCTGGAGAAGGCAAGGTGG + Intronic
1181697040 22:24598798-24598820 AGCGCTTTGGGAGGGCGAGGTGG - Intronic
1181849706 22:25741447-25741469 GGCACTTTGGGAAGCCGAGGTGG - Intergenic
1182282255 22:29224447-29224469 GGCGGCTGGGGAGGGTGAGGGGG + Intronic
1182298024 22:29321355-29321377 GGCCCTTTGGGAGGGCGAGGTGG - Intergenic
1182630392 22:31680712-31680734 GGCACTTCGGGAGGTCGAGGTGG + Intronic
1183160016 22:36106687-36106709 GGCACTTCGGGAGGCCGAGGTGG - Intergenic
1184053095 22:42023440-42023462 AGCACCTCGGGAGGGCAAGGCGG - Intronic
1184201241 22:42971332-42971354 GGCACCTCGGGAGGCTGAGGCGG - Intronic
1184445060 22:44542209-44542231 AGCACTTTGGGAAGGCGAGGCGG + Intergenic
1184459300 22:44628090-44628112 GGGGGCTCTGGGAGGCGAGGAGG - Intergenic
950786128 3:15437398-15437420 GGCACTTTGGGAAGCCGAGGTGG - Intronic
951217926 3:20041262-20041284 GGCGCTTTGGGAAAGCGAAGGGG + Intronic
951264329 3:20548518-20548540 GGCACCTCCGGAGGCCGAGGCGG + Intergenic
952025404 3:29074781-29074803 GACACTTCGGGAGGGCGAGGCGG + Intergenic
952315954 3:32232371-32232393 AGCACTTTGGGAAGGCGAGGTGG - Intergenic
952382674 3:32817221-32817243 GGCGCCCAGGCCAGGCGAGGCGG + Intergenic
952632853 3:35490609-35490631 AGCACCTTGGGAAGCCGAGGCGG + Intergenic
952770185 3:36992969-36992991 GGAGCCTCCGGAGGGCGATGGGG - Exonic
953084768 3:39655539-39655561 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
953404240 3:42652759-42652781 GGAGCCAGGGGAAGGGGAGGTGG - Intergenic
953436351 3:42880868-42880890 AGCCCCTCGGGAGGGAGAGGAGG - Intronic
953954433 3:47220462-47220484 AGCACTTCGGGAAGCCGAGGTGG - Intergenic
954569986 3:51632644-51632666 GGCGCTTTGGGAGGCCGAGGTGG + Intronic
955160772 3:56463465-56463487 GGAGTCTTGGGAAGGTGAGGTGG + Intronic
955256543 3:57338257-57338279 AGCACCTCGGGAGGCCGAGGCGG - Intronic
955626731 3:60927246-60927268 GGCACCTCGGGAGGCCGAGGCGG - Intronic
956018012 3:64904645-64904667 AGCGCTTCGGGAGGCCGAGGTGG + Intergenic
956029817 3:65025379-65025401 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
956395550 3:68822582-68822604 GGCTACTCGGGAGGCCGAGGTGG - Intronic
956678081 3:71753883-71753905 GGCGGCTCGGGGAGCCCAGGAGG + Intronic
957023208 3:75147822-75147844 GGCACTTCGGGAGGCCGAGGCGG - Intergenic
957141344 3:76362249-76362271 AGCTCCTCGGGAAGCTGAGGTGG + Intronic
958431270 3:94043903-94043925 AGCACCTCGGGAGGCCGAGGTGG - Intronic
960047495 3:113211981-113212003 GGCGCCTGGGAAGGGCGAGCCGG - Exonic
960902213 3:122564399-122564421 TGCGCGTCGGGAGGGCGCGGGGG - Exonic
961531063 3:127540725-127540747 GTGGCCTGGGGAAGGCAAGGAGG + Intergenic
961676470 3:128570108-128570130 AGCGACTCGGGAGGCCGAGGCGG + Intergenic
962721176 3:138176285-138176307 AGCACTTCGGGAAGCCGAGGTGG - Intergenic
965302231 3:167018351-167018373 GGCACCTCAGGAGGCCGAGGCGG - Intergenic
965387732 3:168064682-168064704 AGCGACTCAGGAGGGCGAGGTGG - Intronic
965819947 3:172675060-172675082 GGCACCTTGGGAGGCCGAGGCGG + Intronic
966172672 3:177099992-177100014 AGCACTTCGGGAAGCCGAGGCGG + Intronic
966617322 3:181926418-181926440 GGCACCTCGGGAGGCCCAGGCGG + Intergenic
966859565 3:184222320-184222342 GGCTCCTCGGGAGGCTGAGGTGG + Intronic
967164665 3:186769932-186769954 AGCTTCTCGGGAAGCCGAGGTGG - Intergenic
967330779 3:188287146-188287168 AGCACTTCGGGAAGCCGAGGTGG - Intronic
967904004 3:194486514-194486536 GGCGCCGGGGGAGGTCGAGGAGG - Intronic
968192814 3:196682871-196682893 AGCACTTCGGGAAGCCGAGGCGG - Intronic
968261903 3:197332033-197332055 AGCACTTTGGGAAGGCGAGGCGG + Intergenic
968986940 4:3880636-3880658 GGCGCCTCTGGCAGGGGTGGAGG - Intergenic
969431586 4:7158048-7158070 GGGGCCTTTGGGAGGCGAGGAGG + Intergenic
970519021 4:16863905-16863927 AGCACTTCGGGAAGCCGAGGCGG - Intronic
971239491 4:24875059-24875081 AGCACCTTGGGAGGGCGAGGCGG + Intronic
972673932 4:41241002-41241024 GGCGCTTTGGGAGGCCGAGGTGG - Intergenic
973613169 4:52656790-52656812 GGCGCTTCGGGAGGCTGAGGTGG + Intronic
973618094 4:52700557-52700579 AGCACATTGGGAAGGCGAGGCGG - Intergenic
973768226 4:54183128-54183150 AGCACTTCGGGAAGCCGAGGCGG - Intronic
973833857 4:54789641-54789663 GGGGCCTCAGGAAGGAGGGGTGG - Intergenic
973889075 4:55351317-55351339 GGCGCTTTGGGAGGCCGAGGTGG - Intronic
974597756 4:64036892-64036914 AGCACCTCGGGAGGCCGAGGCGG - Intergenic
974607894 4:64176112-64176134 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
975063706 4:70037200-70037222 GGCACCACGGGAGGCCGAGGCGG - Intergenic
975259447 4:72279518-72279540 AGCTACTCGGGAAGGTGAGGTGG - Intergenic
975796032 4:78007634-78007656 GGCACCTCGGGATGCCGAGGCGG + Intergenic
975908667 4:79244873-79244895 GGCACCTCGGGAGGCCGAGGCGG - Intronic
976716985 4:88133748-88133770 AGCACTTCGGGAAGCCGAGGCGG + Intronic
977486896 4:97660246-97660268 AGCACTTCGGGAAGCCGAGGCGG - Intronic
977934649 4:102787248-102787270 GGCTACTCGGGAGGGTGAGGTGG + Intergenic
977939146 4:102839518-102839540 GGCACTTTGGGAAGCCGAGGCGG - Intronic
978225095 4:106322735-106322757 AGCACCTTGGGAAGCCGAGGTGG + Intronic
978527365 4:109679396-109679418 AGCACCTCGGGAGGCCGAGGCGG + Intronic
979482768 4:121238227-121238249 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
979702406 4:123684564-123684586 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
980130556 4:128812289-128812311 GTCGCCTCGGGAGGAGGAGGAGG + Intronic
981223264 4:142261659-142261681 AGTGCCTGGGGAAGGAGAGGTGG - Intronic
981615018 4:146637319-146637341 GGCGCCTGGGGAAGGCGAGCAGG - Intergenic
981767461 4:148267364-148267386 AGCTCCTCGGGAAGCTGAGGTGG - Intronic
981999906 4:151013010-151013032 AGCACCTCAGGAAGCCGAGGCGG - Intronic
982182985 4:152765869-152765891 GGCACCTCGGGAGGCCCAGGCGG + Intronic
982673431 4:158348834-158348856 CGCGCCCAGGGAGGGCGAGGAGG + Intronic
982711087 4:158759433-158759455 AGCACCTCGGGAGGCCGAGGAGG - Intergenic
982894013 4:160893719-160893741 AGCGCTTCGGGAGGCCGAGGTGG - Intergenic
983613871 4:169679639-169679661 GGCACCTTGGGAGGCCGAGGCGG + Intronic
983815153 4:172116515-172116537 AGCACTTCGGGAAGGTGAGGTGG - Intronic
986991292 5:13556124-13556146 GGCACTTTGGGAAGCCGAGGCGG - Intergenic
988561106 5:32282133-32282155 GGCACTTTGGGAGGGCGAGGCGG + Intronic
988711427 5:33780498-33780520 GGTGCCTCCTTAAGGCGAGGTGG + Intronic
990576248 5:57126207-57126229 AGCTACTCGGGAAGGTGAGGCGG - Intergenic
990617060 5:57518947-57518969 AGCACCTCGGGAGGCCGAGGGGG + Intergenic
991222675 5:64234844-64234866 AGCGCCTCGGGAGGCCAAGGAGG - Intronic
991698950 5:69299354-69299376 AGCGCTTTGGGAAGCCGAGGCGG - Intronic
992034901 5:72763358-72763380 AGCGCTTTGGGAAGCCGAGGTGG + Intergenic
992228424 5:74640758-74640780 GGCGCGGCGGGGAGGGGAGGGGG + Exonic
992554118 5:77886595-77886617 AGCACCTTGGGAGGGCGAGGTGG - Intergenic
992611288 5:78510438-78510460 TGCGCGGCGGGAAGGCGGGGCGG - Intronic
992698010 5:79310306-79310328 AGCACTTTGGGAAGGCGAGGCGG - Intronic
993934570 5:93985670-93985692 GGCACCTCGGGAGGCCGAGGCGG - Intronic
994376863 5:99024817-99024839 GGCACTTAGGGAAGCCGAGGTGG + Intergenic
994826151 5:104715037-104715059 AGCACTTCGGGAAGCCGAGGCGG - Intergenic
994949147 5:106434440-106434462 AGCACTTTGGGAAGGCGAGGTGG - Intergenic
997563331 5:134867700-134867722 AGCGCTTTGGGAAGCCGAGGTGG + Intergenic
998286274 5:140863749-140863771 GGCACTTTGGGAAGCCGAGGCGG + Intronic
999365370 5:151020438-151020460 GTCGCCCCGGGACGGGGAGGTGG + Intronic
999978943 5:156940203-156940225 GGCACCTCGGGAGGCCGAGGCGG - Intronic
1000752597 5:165115110-165115132 AGCACCTAGGGAAGCCGAGGCGG + Intergenic
1001395399 5:171415956-171415978 GGCACTTCGGGAGGCCGAGGTGG - Intergenic
1001481910 5:172094481-172094503 GGCTCCTCGGGAGGCTGAGGTGG - Intronic
1001586223 5:172834997-172835019 GGCACCATGGGAAGGGGAGGAGG + Intronic
1001931587 5:175677105-175677127 GGCTACTCGGGAGGCCGAGGTGG - Intronic
1002058120 5:176610194-176610216 GCCGCCTCGGAACCGCGAGGGGG + Intergenic
1002111534 5:176917710-176917732 AGCGCTTCGGGAGGCCGAGGTGG + Intronic
1002118420 5:176983480-176983502 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1002171553 5:177377608-177377630 AGCGCTTTGGGAGGGCGAGGCGG - Intergenic
1002185852 5:177454588-177454610 GGCGCCGAGGGGAGCCGAGGCGG - Intronic
1002384490 5:178856125-178856147 AGCACTTCGGGAGGGCGAGGTGG - Intergenic
1002543421 5:179921773-179921795 AGCACTTTGGGAAGGCGAGGTGG + Intronic
1003101327 6:3178608-3178630 GGGGCCTTGGGAGGCCGAGGCGG - Intergenic
1003627357 6:7754354-7754376 AGCGCTTTGGGAAGCCGAGGAGG - Intronic
1003812791 6:9803583-9803605 GGCCCCTCGGGAGGCCGAGGTGG - Intronic
1004428033 6:15519312-15519334 GGTGCCTTCGGAAGGCGGGGCGG - Intronic
1004720542 6:18264542-18264564 GGCGGTTCGGGAAGGAGAGCGGG + Exonic
1004878769 6:19984360-19984382 AGCACTTCGGGAAGCCGAGGCGG + Intergenic
1005414598 6:25586703-25586725 GGCACCTCGGGAGGCCGAGGCGG + Intronic
1005604759 6:27465235-27465257 AGCACTTCGGGAGGGCGAGGCGG + Intronic
1005933284 6:30499231-30499253 GGCACCTCGGGAGGCCGAGGTGG + Intergenic
1006078672 6:31551271-31551293 GGCACTTTGGGAAGCCGAGGTGG - Intronic
1006172539 6:32102672-32102694 GGCACTTTGGGAAGCCGAGGCGG + Intronic
1006188948 6:32196108-32196130 GGCGGCGCGGGAAGGAGCGGTGG - Exonic
1006192184 6:32216373-32216395 AGCACTTCGGGAAGCCGAGGCGG - Intronic
1007183365 6:39946793-39946815 GGCACCTAGGGAGGGCCAGGTGG + Intergenic
1007548256 6:42710058-42710080 GGGGGCTCAGGGAGGCGAGGTGG - Intronic
1007659850 6:43477481-43477503 GGGGCCTCGGGTTGGGGAGGTGG - Intergenic
1007816778 6:44530560-44530582 GGTGCCTGGGGAAGGGGAGAGGG + Intergenic
1008106422 6:47444385-47444407 GGCACCTCGGGAGGCCCAGGCGG + Intergenic
1008512761 6:52292145-52292167 AGCACTTCGGGAAGCCGAGGCGG + Intergenic
1008523853 6:52388126-52388148 AGCGCCTTGGGAAGCCAAGGTGG + Intronic
1009869276 6:69433810-69433832 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1012162786 6:95907769-95907791 AGCACTTCGGGAAGCCGAGGAGG - Intergenic
1013263749 6:108473047-108473069 GGCACTTTGGGAAGCCGAGGTGG - Intronic
1014026288 6:116650173-116650195 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1014493806 6:122094310-122094332 GGAGCCTCAGAAAGGGGAGGTGG + Intergenic
1014606716 6:123483347-123483369 AGCGCCTTGGGAAGACAAGGCGG - Intronic
1014929828 6:127322056-127322078 GGCACTTTGGGAAGCCGAGGAGG + Intronic
1015355101 6:132268717-132268739 GGCACTTTGGGAAGCCGAGGTGG + Intergenic
1016388271 6:143549671-143549693 GGCAGCTCAGGAAGGGGAGGTGG - Intronic
1016816781 6:148310072-148310094 AGCGCTTTGGGAAGCCGAGGAGG + Intronic
1017151483 6:151284376-151284398 GGCACTTTGGGAAGCCGAGGTGG + Intronic
1017515148 6:155149673-155149695 GGCGCTTTGGGAGGCCGAGGTGG + Intronic
1018025245 6:159800487-159800509 AGGGCCTCGGGAAGGACAGGGGG + Intronic
1018669726 6:166168260-166168282 GGCGCGCTGGGAAAGCGAGGAGG - Intronic
1019128528 6:169857443-169857465 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1019366787 7:637172-637194 GGCTCCTCGGGAGGCTGAGGTGG + Intronic
1019562008 7:1664105-1664127 GGCCCCTCGAGTAGGGGAGGGGG + Intergenic
1019760104 7:2804809-2804831 AGCGCTTTGGGAAGCCGAGGCGG + Intronic
1019945158 7:4322423-4322445 GGCACTTTGGGAAGCCGAGGCGG - Intergenic
1020041218 7:5003215-5003237 GGCTACTCGGGAAGCTGAGGAGG + Intronic
1021995801 7:26177347-26177369 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1022187753 7:27986902-27986924 GGCACCTCGGGAGGCCCAGGCGG - Intronic
1022286827 7:28961533-28961555 GGCACCTTGGGAGGCCGAGGGGG - Intergenic
1022317966 7:29263275-29263297 GGCACCTCGGGAGGCCGAGGCGG - Intronic
1022335108 7:29414832-29414854 GGAGCCTGGGGAAGGCAATGGGG - Intronic
1022674777 7:32488970-32488992 AGCGCTTTGGGAGGGCGAGGTGG - Intronic
1022700209 7:32753419-32753441 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
1023392954 7:39728123-39728145 GTCGCCTCAGGGAGACGAGGTGG - Intergenic
1023954362 7:44872351-44872373 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1025775044 7:64553832-64553854 GGCACCTCGGGAGGCCGTGGCGG - Intronic
1025938335 7:66054928-66054950 GGCACTTTGGGAGGGCGAGGCGG + Intergenic
1025946183 7:66106647-66106669 GGCACTTCGGGAGGACGAGGCGG - Intronic
1026521782 7:71124130-71124152 AGCACCTTGGGAAGCCGAGGCGG - Intergenic
1026835308 7:73635071-73635093 GGCACTTTGGGAAGCCGAGGTGG - Intergenic
1026935603 7:74253475-74253497 AGCACTTTGGGAAGGCGAGGCGG + Intronic
1027145800 7:75693625-75693647 GGCGCTTTGGGAGGCCGAGGTGG + Intronic
1027370943 7:77508659-77508681 GGCACCTCGGGAGGCCAAGGCGG - Intergenic
1027381027 7:77609631-77609653 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1028386879 7:90265037-90265059 AGCGCCTTGGGAGGCCGAGGTGG - Intronic
1028548040 7:92026580-92026602 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1029655494 7:101921707-101921729 GGCACTTCGGGAGGCCGAGGCGG - Intronic
1029689147 7:102169314-102169336 GGCACTTTGGGAAGCCGAGGCGG - Intronic
1030138731 7:106284655-106284677 GGCGGCTGGGGCAGGTGAGGAGG - Intronic
1030329252 7:108255413-108255435 GGCACCTCGGGAGGCCCAGGTGG - Intronic
1031048159 7:116917365-116917387 GGCTACTCGGGAAGCTGAGGTGG - Intronic
1032129364 7:129215982-129216004 AGCACCTCGGGAGGCCGAGGTGG - Intergenic
1032179633 7:129663875-129663897 AGCACCTCGGGAGGCCGAGGTGG + Intronic
1032222312 7:130003888-130003910 GGCGCTTTGGGAGGCCGAGGTGG - Intergenic
1033146852 7:138878511-138878533 AGCACTTTGGGAAGGCGAGGCGG + Intronic
1033281108 7:140007194-140007216 GGGGACTCGGGCAGGGGAGGGGG - Intronic
1033683989 7:143622213-143622235 GGCACCTCGGGAAAGCCACGGGG + Intronic
1033687165 7:143701402-143701424 GGCACCTCGGGAAAGCCACGGGG + Intronic
1033700623 7:143835425-143835447 GGCACCTCGGGAAAGCCACGGGG - Intergenic
1033834282 7:145289995-145290017 GGCACTTTGGGAAGACGAGGCGG + Intergenic
1033934867 7:146571964-146571986 GGCACTTCGGGAGGCCGAGGTGG - Intronic
1034628002 7:152508377-152508399 GGCACTTTGGGAAGACGAGGTGG - Intergenic
1034645002 7:152638364-152638386 GGCTGCTCGGGAAGCTGAGGTGG + Intergenic
1034922735 7:155097145-155097167 GGCACCTCGGGAGGCCAAGGCGG + Intergenic
1034993513 7:155563176-155563198 GGCACTTCGGGAGGCCGAGGCGG + Intergenic
1035167897 7:157002588-157002610 GGGGCCTCGGTAGGGCAAGGAGG + Intronic
1037457052 8:19074035-19074057 GGCACTTTGGGAGGGCGAGGTGG - Intronic
1037750765 8:21680775-21680797 GGAGCCTCGGGAGGGGGAGGGGG - Intergenic
1038266754 8:26044183-26044205 GGCTGCCCGGGAAGACGAGGCGG - Intronic
1038733159 8:30145608-30145630 AGCACTTTGGGAAGGCGAGGTGG + Intronic
1039694820 8:39899402-39899424 GGCACTTTGGGAAGCCGAGGCGG - Intergenic
1040894146 8:52348503-52348525 AGCACTTCGGGAAGCCGAGGCGG + Intronic
1041914932 8:63129262-63129284 AGCACCTTGGGAAGCCGAGGCGG + Intergenic
1042044523 8:64634320-64634342 AGCACCTTGGGAAGGCAAGGTGG + Intronic
1043799477 8:84589143-84589165 GGCGCTTTGGGAGGCCGAGGCGG - Intronic
1044582345 8:93834973-93834995 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1044822193 8:96161819-96161841 GGGTCCACTGGAAGGCGAGGGGG - Intergenic
1044969321 8:97604601-97604623 GGCACCTCGGGAGGCCGAGGCGG - Intergenic
1045022023 8:98052266-98052288 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1046108760 8:109696182-109696204 GGCCCTTCGGGAGGCCGAGGCGG + Intergenic
1046703482 8:117426413-117426435 AGCACCTCGGGATGCCGAGGCGG - Intergenic
1046825483 8:118686659-118686681 TGCGCCTCGGGAGGCTGAGGTGG - Intergenic
1048155825 8:131949699-131949721 GACGCCTTGGGAAGCTGAGGCGG + Intronic
1049145759 8:141000614-141000636 GGGGCCTGAGGAAGACGAGGAGG - Intronic
1049321959 8:142001381-142001403 GGGGACACGGGAAGGCCAGGCGG + Intergenic
1049756560 8:144313645-144313667 GGCGCGGCGGGGAGGCGGGGCGG - Intronic
1049756580 8:144313687-144313709 GGCGGCGCGGGGAGGCGGGGAGG - Intronic
1050417492 9:5432743-5432765 AGCACCTCGGGAGGCCGAGGCGG - Intronic
1050862223 9:10449286-10449308 GGCGCCTCGGGAGGCCCAGGTGG - Intronic
1051442992 9:17106882-17106904 AGCACTTCGGGAAGCCGAGGTGG - Intergenic
1052236324 9:26215646-26215668 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1052274708 9:26663902-26663924 GGCACCTAGGGAGGCCGAGGCGG - Intergenic
1052658196 9:31392415-31392437 GGCACTTTGGGAAGCCGAGGTGG - Intergenic
1052834767 9:33242123-33242145 AGCACCTTGGGAAGCCGAGGCGG - Intronic
1053155790 9:35778050-35778072 AGCGCTTTGGGAAGCCGAGGTGG + Intergenic
1054632172 9:67456432-67456454 AGCACATCGGGAAGCCGAGGTGG + Intergenic
1055089140 9:72344855-72344877 AGCACTTTGGGAAGGCGAGGCGG - Intergenic
1055186302 9:73459276-73459298 AGCACTTCGGGAAGCCGAGGTGG + Intergenic
1055297886 9:74852738-74852760 GGCACCTCGGGAGGCCGAGGCGG - Intronic
1055623818 9:78151901-78151923 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
1055956157 9:81775581-81775603 AGCACCTTGGGAAGCCGAGGTGG - Intergenic
1056166685 9:83947760-83947782 GGCACCTCGGGAGGCCCAGGCGG - Intronic
1056198254 9:84249585-84249607 GAGGCCTGGGGAAGGCCAGGGGG + Intergenic
1056229495 9:84527975-84527997 AGCACCTCGGGAGGCCGAGGTGG + Intergenic
1056815038 9:89795050-89795072 GGCTCCTAGGGAAGGCCACGTGG + Intergenic
1057153908 9:92822379-92822401 AGCACTTCGGGAAGGTGAGGCGG + Intergenic
1058049509 9:100392445-100392467 AGCACCTCGGGAGGCCGAGGTGG - Intergenic
1058244313 9:102604019-102604041 GGCACCTCGGGAGGCTGAGGTGG + Intergenic
1058648562 9:107153793-107153815 GTGGCCACGGGAAGGTGAGGAGG - Intergenic
1058663485 9:107287585-107287607 AGCACCTTGGGAAGCCGAGGCGG + Intronic
1059613214 9:115921609-115921631 GATGCCTCGGGAGGGCGAGGGGG - Intergenic
1059880063 9:118678796-118678818 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1060410021 9:123394243-123394265 GGCGCTTTGGGAGGCCGAGGCGG - Intronic
1060551475 9:124487540-124487562 GCCGTCTCGGGAGGGCGCGGAGG - Intronic
1060757478 9:126223814-126223836 GGTCCCTGGGGAAGGCAAGGAGG - Intergenic
1060928387 9:127471908-127471930 AGCGCTTCGGGAGGCCGAGGTGG - Intronic
1061059922 9:128245174-128245196 GGCGGCTGGGGGAGGAGAGGAGG - Intronic
1061184287 9:129042945-129042967 AGCTCCTTGGGAAGCCGAGGCGG + Intronic
1061828128 9:133274656-133274678 GGCGCCTCGGGAAGGCGAGGTGG - Intronic
1062332253 9:136049915-136049937 GGGGCCCCGGGACGGCGTGGCGG - Exonic
1062350989 9:136138497-136138519 GGGGCCTCTGGATGGGGAGGAGG + Intergenic
1062414910 9:136443435-136443457 AGTGCCTTGGGAAGCCGAGGTGG + Intronic
1062621481 9:137424149-137424171 GGCGGCCCCGGAACGCGAGGGGG - Intronic
1185476961 X:421089-421111 AGCGCTTCGGGAGGCCGAGGCGG + Intergenic
1185477008 X:421353-421375 AGCGCTTCGGGAGGCCGAGGCGG + Intergenic
1185492637 X:529510-529532 AGCACCTTGGGAGGGCGAGGTGG - Intergenic
1186770184 X:12810735-12810757 AGCACCTTGGGAAGCCGAGGCGG + Intronic
1187246398 X:17556323-17556345 GGAGTCTGGGGAAGGCAAGGAGG + Intronic
1187741975 X:22365945-22365967 AGCACCTTGGGAAGCCGAGGTGG + Intergenic
1189882256 X:45504628-45504650 GGCACCTGGGGAGGCCGAGGGGG + Intergenic
1191894307 X:65975793-65975815 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1192350265 X:70350235-70350257 AGCACCTCGGGAGGCCGAGGCGG + Intronic
1192504813 X:71675432-71675454 AGCACCTCGGGAGGCCGAGGCGG - Intergenic
1192886034 X:75336056-75336078 AGCACCTCGGGAGGCCGAGGCGG + Intergenic
1196822803 X:119715919-119715941 AGCACCTTGGGAAGTCGAGGTGG - Intergenic
1198377524 X:136054195-136054217 AGCACCTTGGGAGGGCGAGGTGG + Intergenic
1200082195 X:153583206-153583228 AGCGCTTTGGGAAGCCGAGGCGG + Intergenic
1201440351 Y:14001311-14001333 GGCACCTCGGGAGGCCGAGGCGG + Intergenic
1201444220 Y:14041397-14041419 GGCACCTCGGGAGGCCGAGGCGG - Intergenic