ID: 1061834245

View in Genome Browser
Species Human (GRCh38)
Location 9:133318320-133318342
Sequence AGGGGCCTTCTCCAGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061834242_1061834245 -7 Left 1061834242 9:133318304-133318326 CCTGAGCCTGATAGAGAGGGGCC No data
Right 1061834245 9:133318320-133318342 AGGGGCCTTCTCCAGGTGTCAGG No data
1061834236_1061834245 24 Left 1061834236 9:133318273-133318295 CCAGGGAAGGGGGAGGCTCTGGA No data
Right 1061834245 9:133318320-133318342 AGGGGCCTTCTCCAGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061834245 Original CRISPR AGGGGCCTTCTCCAGGTGTC AGG Intergenic
No off target data available for this crispr