ID: 1061835337

View in Genome Browser
Species Human (GRCh38)
Location 9:133325020-133325042
Sequence CTGTTCCTGGGTGCTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061835337_1061835341 -10 Left 1061835337 9:133325020-133325042 CCAAGGACAGCACCCAGGAACAG No data
Right 1061835341 9:133325033-133325055 CCAGGAACAGCCTTCACTCAGGG No data
1061835337_1061835346 28 Left 1061835337 9:133325020-133325042 CCAAGGACAGCACCCAGGAACAG No data
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data
1061835337_1061835344 23 Left 1061835337 9:133325020-133325042 CCAAGGACAGCACCCAGGAACAG No data
Right 1061835344 9:133325066-133325088 AAACCAACCCTGCTGATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061835337 Original CRISPR CTGTTCCTGGGTGCTGTCCT TGG (reversed) Intergenic
No off target data available for this crispr