ID: 1061835340

View in Genome Browser
Species Human (GRCh38)
Location 9:133325033-133325055
Sequence CCCTGAGTGAAGGCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061835340_1061835344 10 Left 1061835340 9:133325033-133325055 CCAGGAACAGCCTTCACTCAGGG No data
Right 1061835344 9:133325066-133325088 AAACCAACCCTGCTGATGTCTGG No data
1061835340_1061835346 15 Left 1061835340 9:133325033-133325055 CCAGGAACAGCCTTCACTCAGGG No data
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061835340 Original CRISPR CCCTGAGTGAAGGCTGTTCC TGG (reversed) Intergenic
No off target data available for this crispr