ID: 1061835341

View in Genome Browser
Species Human (GRCh38)
Location 9:133325033-133325055
Sequence CCAGGAACAGCCTTCACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061835337_1061835341 -10 Left 1061835337 9:133325020-133325042 CCAAGGACAGCACCCAGGAACAG No data
Right 1061835341 9:133325033-133325055 CCAGGAACAGCCTTCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061835341 Original CRISPR CCAGGAACAGCCTTCACTCA GGG Intergenic
No off target data available for this crispr