ID: 1061835343

View in Genome Browser
Species Human (GRCh38)
Location 9:133325057-133325079
Sequence AGCAGGGTTGGTTTCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5044
Summary {0: 60, 1: 326, 2: 872, 3: 1542, 4: 2244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061835343_1061835346 -9 Left 1061835343 9:133325057-133325079 CCTCAGAAGAAACCAACCCTGCT 0: 60
1: 326
2: 872
3: 1542
4: 2244
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061835343 Original CRISPR AGCAGGGTTGGTTTCTTCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr