ID: 1061835346

View in Genome Browser
Species Human (GRCh38)
Location 9:133325071-133325093
Sequence AACCCTGCTGATGTCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061835343_1061835346 -9 Left 1061835343 9:133325057-133325079 CCTCAGAAGAAACCAACCCTGCT 0: 60
1: 326
2: 872
3: 1542
4: 2244
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data
1061835338_1061835346 16 Left 1061835338 9:133325032-133325054 CCCAGGAACAGCCTTCACTCAGG No data
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data
1061835342_1061835346 5 Left 1061835342 9:133325043-133325065 CCTTCACTCAGGGTCCTCAGAAG No data
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data
1061835337_1061835346 28 Left 1061835337 9:133325020-133325042 CCAAGGACAGCACCCAGGAACAG No data
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data
1061835340_1061835346 15 Left 1061835340 9:133325033-133325055 CCAGGAACAGCCTTCACTCAGGG No data
Right 1061835346 9:133325071-133325093 AACCCTGCTGATGTCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061835346 Original CRISPR AACCCTGCTGATGTCTGGAC TGG Intergenic
No off target data available for this crispr