ID: 1061836290

View in Genome Browser
Species Human (GRCh38)
Location 9:133332253-133332275
Sequence ACCTCACGCCGCTGACCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061836290_1061836299 25 Left 1061836290 9:133332253-133332275 CCTCCCGGTCAGCGGCGTGAGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836290_1061836300 29 Left 1061836290 9:133332253-133332275 CCTCCCGGTCAGCGGCGTGAGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1061836300 9:133332305-133332327 CTGCGCTGCGCCTTGCTGGCCGG 0: 1
1: 0
2: 1
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061836290 Original CRISPR ACCTCACGCCGCTGACCGGG AGG (reversed) Exonic