ID: 1061836299

View in Genome Browser
Species Human (GRCh38)
Location 9:133332301-133332323
Sequence TTTTCTGCGCTGCGCCTTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061836296_1061836299 -7 Left 1061836296 9:133332285-133332307 CCCTCTGCCTCTTCTCTTTTCTG 0: 1
1: 1
2: 14
3: 149
4: 1420
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836290_1061836299 25 Left 1061836290 9:133332253-133332275 CCTCCCGGTCAGCGGCGTGAGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836291_1061836299 22 Left 1061836291 9:133332256-133332278 CCCGGTCAGCGGCGTGAGGTTCC 0: 1
1: 0
2: 0
3: 2
4: 151
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836293_1061836299 1 Left 1061836293 9:133332277-133332299 CCCCTTCACCCTCTGCCTCTTCT 0: 1
1: 1
2: 27
3: 295
4: 2310
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836295_1061836299 -1 Left 1061836295 9:133332279-133332301 CCTTCACCCTCTGCCTCTTCTCT 0: 1
1: 0
2: 21
3: 179
4: 1638
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836294_1061836299 0 Left 1061836294 9:133332278-133332300 CCCTTCACCCTCTGCCTCTTCTC 0: 1
1: 0
2: 9
3: 130
4: 1095
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836297_1061836299 -8 Left 1061836297 9:133332286-133332308 CCTCTGCCTCTTCTCTTTTCTGC 0: 1
1: 0
2: 9
3: 121
4: 1076
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1061836292_1061836299 21 Left 1061836292 9:133332257-133332279 CCGGTCAGCGGCGTGAGGTTCCC 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1061836299 9:133332301-133332323 TTTTCTGCGCTGCGCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061836299 Original CRISPR TTTTCTGCGCTGCGCCTTGC TGG Exonic