ID: 1061839032

View in Genome Browser
Species Human (GRCh38)
Location 9:133347186-133347208
Sequence CCTGCCGCGCAGAGACTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061839032_1061839038 -3 Left 1061839032 9:133347186-133347208 CCCTCCAGTCTCTGCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1061839038 9:133347206-133347228 AGGGAAGAGGTCCTAAAAAGTGG 0: 1
1: 0
2: 4
3: 23
4: 225
1061839032_1061839040 10 Left 1061839032 9:133347186-133347208 CCCTCCAGTCTCTGCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1061839040 9:133347219-133347241 TAAAAAGTGGTCATTCCAACCGG 0: 1
1: 1
2: 1
3: 12
4: 196
1061839032_1061839043 19 Left 1061839032 9:133347186-133347208 CCCTCCAGTCTCTGCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1061839043 9:133347228-133347250 GTCATTCCAACCGGGCGCGGTGG 0: 1
1: 0
2: 5
3: 48
4: 385
1061839032_1061839042 16 Left 1061839032 9:133347186-133347208 CCCTCCAGTCTCTGCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1061839042 9:133347225-133347247 GTGGTCATTCCAACCGGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1061839032_1061839041 11 Left 1061839032 9:133347186-133347208 CCCTCCAGTCTCTGCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1061839041 9:133347220-133347242 AAAAAGTGGTCATTCCAACCGGG 0: 1
1: 0
2: 1
3: 18
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061839032 Original CRISPR CCTGCCGCGCAGAGACTGGA GGG (reversed) Exonic
900219593 1:1500516-1500538 TCTGTCCCCCAGAGACTGGAGGG - Intergenic
900703087 1:4060151-4060173 CCTGCCGGGTAGAGAAGGGAAGG + Intergenic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901405078 1:9039965-9039987 CCAGCCGCGCAGCGTCTGTAGGG + Exonic
902407277 1:16191668-16191690 CCTGCTCTGCAGAGACTGTAGGG - Intergenic
902938028 1:19778866-19778888 CCTCCCGAGCTCAGACTGGAGGG + Intronic
903957480 1:27035330-27035352 CCAGACACGCAGAGACTGGGAGG - Intergenic
915586469 1:156846399-156846421 CCTGGCCCACAGAGGCTGGAAGG - Intronic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
919621172 1:199866100-199866122 CCTGCCGCTCAGAAAATGGTCGG + Intergenic
923111191 1:230891602-230891624 CCTGCTGCGCAGAGATTGTCTGG - Intergenic
1063267908 10:4474767-4474789 CCTGCTGAGGAGAGACTTGAGGG + Intergenic
1064030921 10:11882183-11882205 CCTGCCCAGGAGAGACTGGGTGG + Intergenic
1065437876 10:25720294-25720316 GCTGCCGCACACAGACTTGAGGG - Intergenic
1073442656 10:103561704-103561726 CCTGCCTTGCAGGGATTGGAGGG + Intronic
1073539315 10:104305576-104305598 CATGCTGCGCATAGACAGGATGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079015718 11:16867055-16867077 ACTGCAGCCCAGAGAATGGATGG + Intronic
1080434226 11:32224862-32224884 CCTGCCGTGCAAATAGTGGAAGG - Intergenic
1089679138 11:120109807-120109829 CCTGCTGCACAGAGGCTGGCTGG - Intergenic
1091791323 12:3273777-3273799 CCTGCCCCGCACAGGCAGGAGGG - Intronic
1101842553 12:108339030-108339052 CCTTCCGGGCAGAGACCAGAGGG - Exonic
1102390269 12:112543869-112543891 GCTGCCCCGCAGAGAATGGTCGG + Intergenic
1106514981 13:30445493-30445515 CCAGGAGCACAGAGACTGGATGG + Intergenic
1111886537 13:94028698-94028720 CCTGCCCTCTAGAGACTGGAAGG - Intronic
1113777851 13:112958861-112958883 CCTCCCGCACAGGGTCTGGATGG + Intronic
1114265233 14:21069754-21069776 CCTGCCTAGCAGAGAGCGGAGGG - Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1122232604 14:100314201-100314223 CGTGTGGCGCAGACACTGGAGGG - Intergenic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124241285 15:28030208-28030230 CCAGCCCCTCAGTGACTGGATGG - Intronic
1124632361 15:31345014-31345036 CCTGACCCACAGAGCCTGGAAGG - Intronic
1132201117 15:99955476-99955498 ACTGCCTCCCAGAGGCTGGATGG - Intergenic
1132513539 16:355201-355223 CCTGCCCTGCAGGGACAGGAAGG + Intergenic
1132672159 16:1106381-1106403 GCTGCCTGGCAGAGTCTGGATGG + Intergenic
1132783642 16:1642330-1642352 CCTGCTGTGCTGGGACTGGAGGG - Intronic
1141088001 16:81110498-81110520 CCTGCAGCCCAGACACTGCATGG + Intergenic
1142186053 16:88695206-88695228 GGTGCCGCTCAGTGACTGGAAGG + Intergenic
1144369445 17:14576025-14576047 CCTGCTGAGCAGAGACTAGGGGG - Intergenic
1144759228 17:17698058-17698080 CCTGCAGTCCAGAGACTAGAGGG + Intronic
1151713673 17:75820567-75820589 CCTGCCGGGCAGAGGCTCCAGGG + Intronic
1152727109 17:81952857-81952879 CCTGTCCCGAAGAGACGGGAGGG + Exonic
1155199409 18:23503826-23503848 CCTCCCGCGCTGGGACGGGACGG - Intronic
1158157763 18:54444490-54444512 CCTGACGCCCAGAGACAGGGTGG - Intergenic
1160873058 19:1285794-1285816 CCGGCCGCGCGGGGACTGGGCGG - Intergenic
1161270094 19:3385029-3385051 CCTGCTGAGCAGAGGCGGGAGGG - Intronic
1161353418 19:3806047-3806069 CCTGCCGCCCAGACACCGGCTGG - Exonic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
925380395 2:3421021-3421043 CCTGCCTGACAGAGACTGCAAGG - Intronic
938934955 2:136119326-136119348 CCTCCGGCGCGGAGACTGGGTGG + Intergenic
948783716 2:240340257-240340279 CATCCCGGGCAGACACTGGAAGG - Intergenic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1172763843 20:37340450-37340472 CCTGCCGCACAGAGAGGAGACGG - Intergenic
1175520033 20:59596727-59596749 CCTGCTGAGCAGAGCTTGGAAGG - Intronic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1176167567 20:63682048-63682070 CCTGCAGCCCAGGGCCTGGAGGG + Intronic
1184232997 22:43168591-43168613 CCTGCGGTGCAGAGTCTGGAGGG - Intronic
1184681042 22:46072175-46072197 CCTGCCGCGGAGAGCCCGGCCGG - Intronic
951802659 3:26613559-26613581 ACTGCTGTGCAGAGAATGGAAGG + Intergenic
957904581 3:86540085-86540107 GCTGCCGCACAGAGACATGATGG + Intergenic
961603438 3:128077189-128077211 CCTGCCGCCAAGTGACGGGAGGG + Intronic
962890946 3:139672571-139672593 CCTGCCTTGCACAGACTGGTGGG - Intronic
963520686 3:146357394-146357416 CCTGCTGCACACAGACTTGAGGG - Intergenic
967818622 3:193819511-193819533 CATGCCGCGCAGTGCCTGGATGG + Intergenic
969321119 4:6413524-6413546 CCTGCCGGGCAGATGCTGGTGGG + Intronic
979396560 4:120196489-120196511 CCTGCAGTGAAGAGTCTGGATGG - Intergenic
984608904 4:181816237-181816259 CCTGCTCCTCAAAGACTGGAAGG - Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
987595196 5:19988583-19988605 CCTCCCCCGCAGAGAATTGATGG - Intronic
997610121 5:135209930-135209952 CCTCCCTCTCAGAGACTGGTGGG - Intronic
999696211 5:154190574-154190596 CCTGCAGCGCAGAGACTCGGCGG + Intronic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1002073895 5:176696817-176696839 CCTGCTGCGTGGAGACTGGGTGG - Intergenic
1005816006 6:29553488-29553510 GCTGCCGCGCAGCCACTGCACGG + Intergenic
1015226062 6:130858966-130858988 CCTGCTGCTCACAGGCTGGATGG - Intronic
1019736559 7:2652787-2652809 CCTGCAGAGCAGAGCCTTGATGG + Intronic
1024760790 7:52594135-52594157 CCTGCCCCAATGAGACTGGAGGG + Intergenic
1026062252 7:67036911-67036933 GCTGCTGGGCAGGGACTGGAGGG + Intronic
1029535911 7:101157555-101157577 CTTCCAGGGCAGAGACTGGAGGG - Intronic
1029731189 7:102439268-102439290 CCTGGCTGCCAGAGACTGGAGGG - Intronic
1034633825 7:152551607-152551629 CATGCCGCCCAGAGTTTGGAAGG + Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1036749350 8:11434267-11434289 TCTGCAGCCCAGAGACTGCAGGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1038216337 8:25564918-25564940 CCGGCCAAGAAGAGACTGGAAGG + Intergenic
1045057495 8:98382171-98382193 CCTGCTGCACAGAGCCAGGAAGG - Intergenic
1047195981 8:122721819-122721841 CCTGCTGCACAGAGACTTCAGGG - Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1049423371 8:142526520-142526542 CCTGCCGGGCAGAGAGTGGTGGG - Exonic
1053480489 9:38413104-38413126 CCTGCCTCACAGTTACTGGAGGG + Intronic
1057215336 9:93224759-93224781 CCTCCCTCCCAGACACTGGAGGG - Intronic
1061839032 9:133347186-133347208 CCTGCCGCGCAGAGACTGGAGGG - Exonic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062084263 9:134640905-134640927 CCTACCACCCAGAGACTGGCGGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1196051410 X:111309402-111309424 CCTGCTGCCCAGAGACTTGATGG + Intronic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic