ID: 1061839541

View in Genome Browser
Species Human (GRCh38)
Location 9:133349882-133349904
Sequence AACACTCTTCAGTTTAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061839541_1061839544 5 Left 1061839541 9:133349882-133349904 CCAAGCCTAAACTGAAGAGTGTT 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1061839544 9:133349910-133349932 AGCTACTCAGCTGCTTAAGCTGG 0: 19
1: 13
2: 13
3: 63
4: 1043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061839541 Original CRISPR AACACTCTTCAGTTTAGGCT TGG (reversed) Intronic