ID: 1061840041

View in Genome Browser
Species Human (GRCh38)
Location 9:133353379-133353401
Sequence GCCCTACCTTGAGGGAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061840041_1061840049 9 Left 1061840041 9:133353379-133353401 CCTCCACTCCCTCAAGGTAGGGC 0: 1
1: 0
2: 4
3: 30
4: 321
Right 1061840049 9:133353411-133353433 TTCTCTTGAAGTCCTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061840041 Original CRISPR GCCCTACCTTGAGGGAGTGG AGG (reversed) Intronic
900473038 1:2863863-2863885 GCCCTGCCCGGAGGGAGTTGGGG - Intergenic
900609737 1:3539463-3539485 GCCCTGCCAGGAGGGAATGGTGG + Intronic
901641560 1:10695358-10695380 GCCCAACTTTGAGGGAGGAGTGG - Intronic
901674090 1:10872870-10872892 CCCCTCCCTTGATGGAGTGTGGG - Intergenic
902503676 1:16926203-16926225 GCCCCACCTGGAGGCAGGGGTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902552097 1:17225242-17225264 GCCCTGCCTTGTGGGTCTGGTGG + Intronic
902747641 1:18483870-18483892 GCCCTGGCCAGAGGGAGTGGTGG + Exonic
903177667 1:21590386-21590408 GCCCCTCCTTGGGGGCGTGGTGG - Intergenic
903435446 1:23345317-23345339 GCCCCACCCTTAGGAAGTGGAGG + Intergenic
903830670 1:26172177-26172199 GCCCTCCCTTGAGGTAGGGGCGG - Intergenic
904796048 1:33057271-33057293 GCCCTACCCTGAGGGAGACAGGG + Intronic
906558520 1:46735430-46735452 TCCCCAGCTTGAGGGCGTGGAGG + Intergenic
906766469 1:48439047-48439069 GCCATACCCTGAGGGAGGGAAGG - Intronic
908659916 1:66424672-66424694 GCCATACCCTGAGGGAGGGAAGG + Intergenic
910669993 1:89763087-89763109 GCCCTCCCTGGAGTGAGCGGCGG + Intronic
910689770 1:89954129-89954151 GCTCTCCCTAGATGGAGTGGGGG - Intergenic
911129962 1:94377548-94377570 GCCATACCCTGAGGGAGGGAAGG + Intergenic
912021117 1:105110368-105110390 GCCATACCCTGAGGGAGGGAAGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913469317 1:119173565-119173587 GCCATACCCTGAGGGAGGGAAGG - Intergenic
913522224 1:119655474-119655496 TCCCAACCTTGAGGGATTAGAGG - Intergenic
914762680 1:150611754-150611776 CCCCTTCCTTGAGGGTGTGCTGG - Intronic
914913174 1:151802619-151802641 CTCCTACCTGGAGGGAGCGGTGG - Exonic
915260385 1:154672830-154672852 GCCATACCCTGAGGGAGGGAAGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916007654 1:160676965-160676987 GCACTGCCTTGAGGGATGGGAGG + Intergenic
916083431 1:161251397-161251419 GCCATACCCTGAGGGAGGGAAGG - Intergenic
916786845 1:168092771-168092793 GGCCTAGCTTGAGGGCGGGGAGG - Intronic
917227379 1:172799583-172799605 GCCATACCCTGAGGGAGGGAAGG - Intergenic
917279721 1:173369195-173369217 GCCATACCCTGAGGGAGGGAAGG - Intergenic
917280953 1:173377883-173377905 GCCGTACCCTGAGGGAGGGGAGG - Intergenic
917445994 1:175106254-175106276 GCCATACCCTGAGGGAGGGAGGG + Intronic
917676090 1:177320887-177320909 GCCATACCCTGAGGGAGGGAAGG - Intergenic
918157761 1:181866462-181866484 GGCCTACTTTGAGTGAGGGGAGG + Intergenic
918325100 1:183402727-183402749 GTCCTGCCTTGAGGGAGTGGAGG - Intronic
919887071 1:201942359-201942381 GCCTGACCTTGAGGGAGTCCTGG + Intronic
920211296 1:204330750-204330772 GCCCCACCATGAGGTTGTGGAGG + Intronic
920340461 1:205272321-205272343 GCCCTACCTGGAGATAGTGCGGG + Exonic
920960090 1:210656276-210656298 GACCTACATAGAGGAAGTGGCGG + Intronic
921902310 1:220463480-220463502 GCCCCACCCTCAGGCAGTGGAGG + Intergenic
923307819 1:232704243-232704265 ACCTGACCTTGAGAGAGTGGGGG + Intergenic
1062894199 10:1090484-1090506 GACCTAACTAAAGGGAGTGGTGG + Intronic
1063608489 10:7543447-7543469 GGCCTCCCTTGGGGGAGTGTTGG + Intergenic
1063859261 10:10290375-10290397 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1065082244 10:22140139-22140161 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1066614747 10:37283286-37283308 GCCATACCCTGAGGGAGGGGAGG + Intronic
1067053661 10:43039210-43039232 GCCCCACCCGGAGAGAGTGGGGG - Intergenic
1068083287 10:52346586-52346608 GCCCAGCCATGAGGGTGTGGGGG - Intergenic
1069137507 10:64783547-64783569 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1069640192 10:69949895-69949917 GCCCAACTTTGGGGGGGTGGGGG + Intronic
1071571318 10:86698999-86699021 TCCCTGCCTTGAGTGAGTTGGGG - Intronic
1071834676 10:89407630-89407652 GCCATACCCTGAGGGAGGGAAGG - Intronic
1071877206 10:89854165-89854187 GCCCTACCTTGTGAGGGTGAAGG - Intergenic
1072196209 10:93119100-93119122 GCCCTTCCTTGAGGCAGTCCTGG + Intergenic
1072371821 10:94772109-94772131 GCCATACCCTGAGGGAGGGAAGG + Intronic
1072753298 10:97999641-97999663 GCCCTACCTTTAGGGCAGGGAGG + Intronic
1073326710 10:102647521-102647543 GCCCTCCCAGGAGGGAGAGGAGG + Intronic
1074612845 10:115038305-115038327 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1074742805 10:116501071-116501093 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1075270255 10:121043208-121043230 GGCCGACCTGGAGGGAGAGGGGG - Intergenic
1075582808 10:123634893-123634915 GTCCTAGCCTGAGGGAGTGTTGG - Intergenic
1075607982 10:123829594-123829616 GCCTTAACTTGAGGGACTGAGGG - Intronic
1075800417 10:125150203-125150225 GCCCTCCCTCGAGGGAGATGGGG + Intronic
1075843939 10:125529646-125529668 CCCCTACTTTGAGGGTGAGGGGG - Intergenic
1076996365 11:299246-299268 CCCCCACCTTGATGGAGTAGTGG + Intronic
1077373058 11:2192640-2192662 GCCATTCCCGGAGGGAGTGGAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081978915 11:47254151-47254173 GCCCCATCTTGTGGGAGTGGGGG - Intronic
1082906302 11:58311431-58311453 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1083400301 11:62418803-62418825 GCCCTGCCTGGAGGCAGTGAAGG - Intronic
1084157630 11:67323012-67323034 GCACTACCTAGAGGGAGGAGAGG - Intronic
1086158342 11:83693394-83693416 GCCCTTCCTGAAGGGACTGGAGG - Intronic
1086317224 11:85607828-85607850 GCCATACCCTGAGGGAGGGGAGG - Intronic
1087263321 11:96035068-96035090 AAGCTACCTTGAGGAAGTGGAGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090944964 11:131421390-131421412 GCCCTGCCTGGGGGGAGAGGAGG + Intronic
1091240431 11:134048333-134048355 CCCCCACCTTGGGGTAGTGGGGG + Intergenic
1093580726 12:20782039-20782061 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1094338284 12:29384503-29384525 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1095048122 12:37532908-37532930 GGCCTGCCTAGAGGGTGTGGAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096124099 12:49107129-49107151 GCCTTATCTTGAGGAAGTGATGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097428160 12:59472287-59472309 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1099414910 12:82373204-82373226 GCCATACCCTGAGGGAGGGAAGG + Intronic
1100050923 12:90447034-90447056 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1100092006 12:90984063-90984085 GCCATACCCTGAGGGAGGGATGG - Intronic
1100209641 12:92388004-92388026 GCCATACCCTGAGGGAGGGACGG - Intergenic
1100530457 12:95457002-95457024 GCCATACCCTGAGGGAGAGAAGG + Intergenic
1101779497 12:107822973-107822995 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1104174323 12:126315062-126315084 GCCCTAGCTGGAAGGAGTGCTGG - Intergenic
1104766942 12:131336187-131336209 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1105762299 13:23526095-23526117 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1107792882 13:44019840-44019862 GCCCTAGGGTGAGGGTGTGGAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109424162 13:62150232-62150254 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1111372396 13:87334938-87334960 GCCATACCTTGAGGGAGGGAAGG - Intergenic
1112518949 13:100079606-100079628 GCCATACCCTGAGGGAGGGCAGG - Intergenic
1113204084 13:107896051-107896073 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1113551677 13:111197565-111197587 GCCATACCCTGAGGGAGAGAAGG + Intronic
1113894799 13:113756992-113757014 GACCAAGCTTGAGGGCGTGGAGG - Intergenic
1114549721 14:23525816-23525838 GCCCCACCTTGAGATCGTGGAGG + Exonic
1116812389 14:49551896-49551918 CCCCTACCCTGAGGGAGATGAGG - Intergenic
1117468911 14:56022347-56022369 GCCCCACCTTCAGGGTCTGGTGG - Intergenic
1119426158 14:74535793-74535815 GCCCCAGCTTTGGGGAGTGGTGG - Intronic
1119806054 14:77483047-77483069 GCCCTACCATGAGGAATTGGAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120198634 14:81514339-81514361 GCCATACCCTAAGGGAGGGGAGG - Intronic
1120824403 14:88942454-88942476 GCTCTGCCTGCAGGGAGTGGGGG + Intergenic
1120986612 14:90340827-90340849 GCCCCACCTCCAGGGAGTGAAGG + Intergenic
1122783017 14:104151592-104151614 GCTCTGCCTTGAGTGAGTGTGGG + Intronic
1122886557 14:104712977-104712999 GCCCCACCTTCAGGGCGCGGAGG - Exonic
1125505860 15:40267209-40267231 GCCCTCCCAGGAGGGAGGGGAGG - Intronic
1126085971 15:45011582-45011604 GCCATACCTTGAGGGAGGGAAGG - Intergenic
1126777597 15:52112777-52112799 GCCCTACCCTGGGGGAGGCGCGG - Intergenic
1127892773 15:63269870-63269892 GACCAACCTTGAGGGGGTAGGGG - Intergenic
1127957295 15:63864319-63864341 GCCCTCCCTTTAGGGAAGGGAGG + Intergenic
1127987780 15:64087575-64087597 GCCACATCTTGAGGGACTGGAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1133150308 16:3823496-3823518 GCCCTCCCTGCAGAGAGTGGTGG - Intronic
1135339835 16:21636124-21636146 GCCATACCCTGAGGGAGGGAAGG + Intronic
1138786424 16:59851979-59852001 GCCCTCCCTGGAGGGAGCAGAGG + Intergenic
1143179139 17:4973479-4973501 GCCCTACCAAGAGGGAGTTGGGG - Intronic
1144786918 17:17837074-17837096 GCCCCACCTTGAGAGAGCGGGGG + Intergenic
1145272974 17:21414512-21414534 GTGCTACCCTTAGGGAGTGGTGG + Intronic
1145311176 17:21701956-21701978 GTGCTACCCTTAGGGAGTGGTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146313338 17:31788080-31788102 AGCCTACTTTTAGGGAGTGGTGG + Intergenic
1148626895 17:49076274-49076296 GGCCGACCTTGGGTGAGTGGTGG - Intergenic
1149213329 17:54328072-54328094 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1149461692 17:56834245-56834267 GCCCTACCTCGCGCGGGTGGAGG - Exonic
1149602933 17:57904756-57904778 GCCCTACCGTAGGGGAGTGGGGG + Intronic
1150538399 17:66070544-66070566 TCACTCCCTTGAGGGAGCGGGGG - Intronic
1151558739 17:74860021-74860043 GACCCAGCTTGGGGGAGTGGGGG - Intronic
1151567836 17:74909682-74909704 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1152519812 17:80848848-80848870 CTCCTTCCTTGAGGGAGTGTGGG - Intronic
1153736702 18:8078191-8078213 GACCTACCTCGAGGGAGCTGGGG - Intronic
1155881660 18:31156884-31156906 GCCCTCTCTTCAGAGAGTGGAGG - Intronic
1156419300 18:36933643-36933665 GCCCAACCCAGAGGGTGTGGAGG - Intronic
1156830644 18:41486832-41486854 GCCCTGGCTTCATGGAGTGGTGG + Intergenic
1157578314 18:48758571-48758593 GCCCTACCTGCTGGCAGTGGTGG - Intronic
1157858085 18:51119256-51119278 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1157934805 18:51861135-51861157 GCCCCACATTTAGGAAGTGGTGG + Intergenic
1158412599 18:57221358-57221380 GCCCTACCCTAAGGAAGGGGTGG - Intergenic
1159136556 18:64343593-64343615 GCCCTGCCTTTAGGTATTGGAGG + Intergenic
1160898623 19:1415488-1415510 GCCCTTCCTTCATGGGGTGGGGG + Intronic
1161598387 19:5164602-5164624 GCCATACCCTGAGGGAGGGAAGG + Intronic
1162745208 19:12793973-12793995 GCCCTTCCTGGAGGGGGTGGGGG - Intronic
1162797896 19:13096014-13096036 ACCCTCCCTTGAGGGAGGAGGGG - Exonic
1162921651 19:13906547-13906569 GCCCTTCCCTGAGCGAGTGACGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164302893 19:23977522-23977544 GCCCTACCTACAGGGAGTATGGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164463111 19:28465205-28465227 GCCCTAACATGGGAGAGTGGAGG + Intergenic
1164993141 19:32698927-32698949 GCCATACCCTGAGGGAGGGAAGG + Intronic
1165846927 19:38824130-38824152 GCCATACCCTGAGGGAGGGAAGG - Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167267395 19:48490481-48490503 GCCCAGGCTGGAGGGAGTGGTGG - Intronic
925950084 2:8901540-8901562 GCCATACCCTGAGGGAGGGAAGG + Intronic
926668397 2:15550187-15550209 GCATTTCCATGAGGGAGTGGGGG + Intronic
927210355 2:20635266-20635288 GCCCTTGCTTGTGGGCGTGGCGG - Intronic
928940451 2:36721819-36721841 GCCCAACCTAAAGGGGGTGGAGG - Intronic
929330186 2:40673327-40673349 GCCATACCCTGAGGGAGGGAAGG - Intergenic
929553172 2:42907028-42907050 CGCCTGCCTCGAGGGAGTGGGGG + Intergenic
930005371 2:46892255-46892277 GCCCCACCTTGAGGCAGGGGAGG + Intergenic
930038330 2:47101819-47101841 GCCATACCCTGAGGGAGGGAAGG - Intronic
931540301 2:63323570-63323592 GCCATACCCTGAGGGAGGGAAGG - Intronic
933591091 2:84233471-84233493 GCCCTGCCATAAGGGAGAGGAGG - Intergenic
935082505 2:99812072-99812094 GTCTTACCTTGAGGGGGTGTGGG + Intronic
936373614 2:111922730-111922752 GCCATACCTTGAGGTGGTGAGGG + Intronic
938778170 2:134560102-134560124 GCCCTAACCTGAAGGAGGGGAGG - Intronic
938806365 2:134810154-134810176 GCCATACCCTGAGGGAGGGGAGG + Intergenic
942972898 2:181978621-181978643 GTCCTAGCTGGAGGGACTGGAGG + Intronic
946207538 2:218120691-218120713 GCCATACCCTGAGGGAGGGAAGG + Intergenic
948514976 2:238498178-238498200 GCCCTGCCCTCAGGGAGGGGTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948835761 2:240625331-240625353 GCCCCAGCTAGAGGGCGTGGGGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
949074835 2:242048051-242048073 GTCCTACCTTGAATGAGTGATGG + Intergenic
1169914379 20:10672212-10672234 GTCCTTCCTGGAGGGTGTGGGGG - Intronic
1171261336 20:23737179-23737201 GCCATAGCCTGAGGGAGGGGAGG - Intergenic
1171270464 20:23813070-23813092 GCCGTATCCTGAGGGAGGGGAGG - Intergenic
1171798392 20:29584143-29584165 GGCCTGCCTGGAGGGTGTGGGGG - Intergenic
1171845702 20:30273030-30273052 GGCCTGCCTGGAGGGTGTGGGGG + Intergenic
1176904482 21:14483257-14483279 GCCCCACGTTGAGGGAGCTGAGG + Intergenic
1177134912 21:17298199-17298221 GCCATACCTTGAGGGAGGAAAGG - Intergenic
1178187814 21:30243770-30243792 CAGCTACATTGAGGGAGTGGGGG - Intergenic
1178601079 21:33994590-33994612 GCCCTACCTAGAGGTAGGTGAGG + Intergenic
1180155001 21:45973369-45973391 GCCCTCCCTGGAGGGCGTGTTGG + Intergenic
1183430503 22:37762834-37762856 GCCCTTCCTTCAGGGGTTGGGGG + Intronic
1183749288 22:39710558-39710580 GCCCTGCCCTGAGGGCATGGAGG + Intergenic
1184151812 22:42643831-42643853 GCCCTACCTGGAGGATGGGGAGG + Intronic
1184195380 22:42924138-42924160 GCCCCAGCTTTAGGGAGCGGGGG + Intronic
1184259154 22:43304812-43304834 GCCCTACCTGGAGTGAGTGGAGG - Intronic
1184456838 22:44615798-44615820 GCCCAACTTCGAGGGACTGGTGG - Intergenic
1185026184 22:48414606-48414628 GCCCTACTTTGGGCCAGTGGCGG - Intergenic
949672262 3:6412725-6412747 GCCCTAGCTTTAGTCAGTGGGGG + Intergenic
950487354 3:13281550-13281572 GCCCTGCCTGGAGGGTGTGCTGG - Intergenic
950719981 3:14875771-14875793 GCCCAGGCTGGAGGGAGTGGAGG + Intronic
952555232 3:34523057-34523079 GCCATACCCTGAGGGAGGGAAGG + Intergenic
953623131 3:44549673-44549695 GCCATACCCTGAGGGAGGGAAGG + Intergenic
953749696 3:45599897-45599919 GACCTACCTTGGGGCAGAGGAGG + Intronic
953773146 3:45794138-45794160 GTCCCACCTGGAGGGAATGGTGG + Intronic
954232445 3:49227744-49227766 GCCATACCCTGAGGGAGGGGAGG + Intronic
954598742 3:51851411-51851433 GCCATACCCTGAGGGAGGTGAGG - Intergenic
955082525 3:55671446-55671468 GCCCTAACTTGGGACAGTGGTGG + Intronic
957646557 3:82938897-82938919 GCCCTACCGAGTGGGTGTGGTGG + Intergenic
958549402 3:95594243-95594265 GCCATACCCTGAGGGAGGGAAGG + Intergenic
958575971 3:95950210-95950232 GCCATACCCTGAGGGAGGGGAGG + Intergenic
958601201 3:96298957-96298979 GCCATACCCTGAGGGAGGGAAGG - Intergenic
959873249 3:111352216-111352238 ACCAAACATTGAGGGAGTGGTGG - Intronic
961453743 3:127014360-127014382 GCCCTACCTTGAGGATCTTGGGG - Exonic
961520917 3:127466999-127467021 GCTCTACCTTGTGGGGGTGTTGG - Intergenic
961614294 3:128166696-128166718 GCCGCACCTTGGGAGAGTGGAGG - Intronic
963021083 3:140873675-140873697 GCCATACCCTGAGGGAGGGGAGG - Intergenic
963992473 3:151669629-151669651 GCCATACCCTGAGGGAGGGGAGG + Intergenic
965062570 3:163802930-163802952 GCCATACCCTGAGGGAGGGAAGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
965961941 3:174440011-174440033 GTCCTGCCGGGAGGGAGTGGAGG - Intronic
966819716 3:183915027-183915049 GGCCTACCTTGCTGGAGTGGGGG - Intergenic
967583446 3:191186768-191186790 GCCATACCCTGAGGGAGGGGAGG - Intergenic
968570124 4:1335009-1335031 GCCACACCTGGAGGGAGGGGAGG - Intronic
968650943 4:1760051-1760073 GCCCCACCTCCTGGGAGTGGAGG - Intergenic
971208133 4:24589917-24589939 GCCTTAACTTGTGGGATTGGAGG - Intergenic
971281383 4:25244982-25245004 GCCATACCCTGAGGGAGGGAAGG + Intronic
972133467 4:35863782-35863804 GCCATACCCTGAGGGAGGGAAGG + Intergenic
973045682 4:45532703-45532725 GCCATACCCTGAGGGAGGGACGG - Intergenic
974287377 4:59886312-59886334 GCCCTACTTTGTGGGGGTGGGGG - Intergenic
974526372 4:63054184-63054206 GCCGTACCTTGAGGGAGGGGAGG - Intergenic
975596045 4:76048932-76048954 GCCATACCCTGAGGGAGGGAAGG + Intronic
976174514 4:82337779-82337801 GCCATACCCTGAGGGAGGGAAGG + Intergenic
977883905 4:102236564-102236586 GCCATACCCTGAGGGAGGGAAGG - Intergenic
978556515 4:109986685-109986707 GCCCTACCTTTTTGGAGTTGGGG - Intronic
981522284 4:145675793-145675815 GCTCTACCTTCAGAGAGTGTAGG - Intergenic
982700932 4:158659233-158659255 GCCATACCCTGAGGGAGGGAAGG - Intergenic
982877111 4:160663611-160663633 GCCATACCCTGAGGGAGGGAAGG - Intergenic
983835120 4:172375915-172375937 GCCATACCCTGAGGGAGGGAAGG + Intronic
984917270 4:184735864-184735886 GCCATACCCTGAGGGAGGGAAGG - Intergenic
986215104 5:5712704-5712726 GCCCTACCTTCAGGGCTTGAAGG - Intergenic
986769459 5:10958473-10958495 GCCATACCTAGAGGGAGAGGTGG - Intergenic
987545436 5:19306126-19306148 GCCATACCCTGAGGGAGTGGAGG + Intergenic
987929691 5:24388367-24388389 GCCATACCCTGAGGGAGGGAAGG - Intergenic
988357640 5:30198975-30198997 GCCATACCCTGAGGGAGGGAAGG - Intergenic
989496061 5:42112654-42112676 GCCATACCTTGAGGGAGGGAAGG - Intergenic
989608857 5:43272558-43272580 GCCTTACCGTGAGGGGCTGGGGG - Intronic
989957157 5:50371591-50371613 GCCATACCTTGAGGGAGGAAAGG - Intergenic
990116541 5:52398557-52398579 GCCATACCCTGAGGGAGGGAAGG - Intergenic
990368075 5:55090001-55090023 GCCATACCCTGAGGGAGGGAAGG + Intergenic
992545570 5:77811280-77811302 GCCATACCCTGAGGGAGGGAAGG - Intronic
996680183 5:126222636-126222658 GCCATACCCTGAGGGAGGGGAGG - Intergenic
997598180 5:135121040-135121062 ACCCTACCCTGATGGAGTTGGGG + Intronic
998326607 5:141286521-141286543 GTCCTCCCTTGAGGGAGGGAGGG - Intergenic
1000246490 5:159452718-159452740 GCTCTTCCTTGAGGGAATGAAGG + Intergenic
1003168088 6:3698901-3698923 GCCCAACCTCCAGGGAATGGAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003805589 6:9723481-9723503 GCCATACCCTGACGGAGGGGAGG - Intronic
1004812049 6:19272564-19272586 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1005696168 6:28354714-28354736 TCCCTACCTTTAGGGTGTTGGGG + Intronic
1006638960 6:35479270-35479292 GCCCTCCCCAGTGGGAGTGGGGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007054119 6:38864673-38864695 GACCTAACTTCAGGGGGTGGTGG + Intronic
1007479375 6:42140176-42140198 GCCCTGCCTTGAGGAACGGGAGG + Intronic
1008199184 6:48564984-48565006 GCCCTACCTTGTGGAACTGTGGG + Intergenic
1008587205 6:52960790-52960812 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1009407917 6:63331974-63331996 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1009470578 6:64025800-64025822 GCCATACCCTGAGGGAGGGAAGG - Intronic
1009872584 6:69469473-69469495 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1010269628 6:73905140-73905162 GCCATACCCTGAGGGAGAGAAGG - Intergenic
1012441734 6:99267375-99267397 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1013977221 6:116092350-116092372 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1016183819 6:141177421-141177443 GCCATATCCTGAGGGAGGGGAGG - Intergenic
1017820827 6:158048140-158048162 TCCCTACCTTCAGGGAGCAGGGG + Intronic
1017859177 6:158379325-158379347 GCCCTACCTCAAGAGAGTTGGGG - Intronic
1018811550 6:167301773-167301795 GCGCTGCCTTCAGTGAGTGGAGG + Intronic
1020233329 7:6336735-6336757 ACCCAACCTTGAGGAAGTCGAGG - Intronic
1022669071 7:32438957-32438979 GCCCTACCTGGTGGGTGTGATGG + Intergenic
1024735087 7:52296152-52296174 GCCATAACCTGAGGGAGGGGAGG - Intergenic
1026566884 7:71496576-71496598 GCCCAACCTGAAAGGAGTGGAGG + Intronic
1026771702 7:73205558-73205580 GCCCTGCCTTCAGGGAATGTGGG + Intergenic
1027012570 7:74758955-74758977 GCCCTGCCTTCAGGGAATGTGGG + Intronic
1027075470 7:75187098-75187120 GCCCTGCCTTCAGGGAATGTGGG - Intergenic
1027135997 7:75624417-75624439 GCCCTTCCTTAGGGGAGTGGGGG + Intronic
1027790918 7:82638349-82638371 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1028495430 7:91455152-91455174 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1030420313 7:109300454-109300476 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1033133935 7:138769026-138769048 GGCCCACCTGGAGGGAATGGGGG - Intronic
1033433589 7:141312027-141312049 GCCCCACCTTGAGGTAGGGATGG - Intronic
1034427865 7:151024025-151024047 GCACTGCTGTGAGGGAGTGGGGG + Exonic
1034580198 7:152035023-152035045 GCCATATCCTGAGGGAGGGGAGG + Intronic
1038638588 8:29306313-29306335 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1039275802 8:35933309-35933331 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1039634799 8:39152821-39152843 GCCCTACCTAGAGGTAAGGGAGG - Intronic
1039757578 8:40539970-40539992 GCCCAACCTTTAGGGAGGAGAGG + Intronic
1040526982 8:48234221-48234243 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1040797033 8:51298237-51298259 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1040965271 8:53075838-53075860 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1040971666 8:53142228-53142250 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1042771721 8:72389320-72389342 GCCATATCTTGAGGGAGGGAAGG - Intergenic
1042919415 8:73907363-73907385 GCCATAACTTGAGGGAGGGAAGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043256876 8:78149034-78149056 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1044005620 8:86933060-86933082 GCCATACCCTGAGGGAGGGAAGG + Intronic
1044456838 8:92399629-92399651 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1044948283 8:97411870-97411892 GAACTAGCTTTAGGGAGTGGCGG - Intergenic
1045858353 8:106789920-106789942 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1046547497 8:115669338-115669360 GACTTACCTTGGGGTAGTGGGGG + Intronic
1048015211 8:130491062-130491084 GCCCTGCCTTGTGGGGGTGGTGG + Intergenic
1049254307 8:141605650-141605672 TGCCCACCTTGAGGCAGTGGCGG - Intergenic
1049299746 8:141863199-141863221 GCCCTGCGTTGTGGGGGTGGTGG - Intergenic
1049339797 8:142105971-142105993 CCCTGACCTGGAGGGAGTGGGGG - Intergenic
1050508087 9:6368353-6368375 GCCCTGGGATGAGGGAGTGGTGG - Intergenic
1050692892 9:8248495-8248517 GCACTACCTGGAGGGAGAAGTGG - Intergenic
1052057990 9:23924615-23924637 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1054162378 9:61682816-61682838 GGCCTGCCTAGAGGGTGTGGGGG - Intergenic
1055458488 9:76494402-76494424 GCCATACCCTGAGGGAGGGAAGG + Intronic
1058906179 9:109484370-109484392 GCCCTGGAGTGAGGGAGTGGGGG + Intronic
1059043784 9:110842501-110842523 GCTCTGTCTTGAAGGAGTGGAGG + Intergenic
1060034329 9:120242193-120242215 GCCCTGCCTTGAGGGATTCGGGG + Intergenic
1060776447 9:126378227-126378249 ACCCTGCCTTGAGTCAGTGGTGG + Intronic
1061840041 9:133353379-133353401 GCCCTACCTTGAGGGAGTGGAGG - Intronic
1062237953 9:135521704-135521726 GCCCTGCCCTGAGGGAATGGTGG + Intronic
1062245210 9:135562564-135562586 GCCCTTCCATGAGGGTGGGGTGG + Intronic
1062277293 9:135736975-135736997 CCCCTACGTGGGGGGAGTGGGGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186868273 X:13742960-13742982 CCCCTTCCTGAAGGGAGTGGGGG + Intronic
1188092069 X:25976684-25976706 CCCCTTCATTGTGGGAGTGGGGG - Intergenic
1188136288 X:26498645-26498667 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1190230006 X:48574770-48574792 GGCCTACCGGGAGGGACTGGTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1192126391 X:68504354-68504376 GCCCAAACTTTCGGGAGTGGTGG - Intronic
1192483029 X:71501110-71501132 GCCATACCCTGAGGGAGGGAAGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195439346 X:104883926-104883948 GCCATACCCTGAGGGAGGGGAGG - Intronic
1197513191 X:127396282-127396304 GCCATACCCTAAGGGAGGGGAGG - Intergenic
1198387648 X:136144874-136144896 GCCTTTCCATGATGGAGTGGGGG + Intergenic
1199208926 X:145183221-145183243 GCCCTACCTGGAGAGACTGAAGG + Intergenic
1199976651 X:152898268-152898290 GCCCTGCTTGGAGGCAGTGGGGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200711074 Y:6485539-6485561 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1200776032 Y:7171130-7171152 GCCCAACCCTGAGGGAGAGAAGG - Intergenic
1201022860 Y:9676447-9676469 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1201312252 Y:12607446-12607468 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201429479 Y:13890204-13890226 GCCATACCTTGAGGGAGGGAAGG - Intergenic
1201468626 Y:14311489-14311511 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1201487361 Y:14507574-14507596 GCCATACCCTGAGGGAGGGAAGG - Intergenic
1201496610 Y:14596067-14596089 GCCATACCCTGAGGGAGGGAAGG + Intronic
1201555536 Y:15262061-15262083 GCCGTACCCTGAGGGAGGGAAGG - Intergenic
1201568767 Y:15392486-15392508 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1201989719 Y:20010233-20010255 GCCATACCCTGAGGGAGGGAAGG + Intergenic
1202272287 Y:23083668-23083690 GCCATACCCTGAGGGAGGGAGGG + Intergenic
1202293739 Y:23337014-23337036 GCCATACCCTGAGGGAGGGAGGG - Intergenic
1202425284 Y:24717412-24717434 GCCATACCCTGAGGGAGGGAGGG + Intergenic
1202445505 Y:24952673-24952695 GCCATACCCTGAGGGAGGGAGGG - Intergenic