ID: 1061840577

View in Genome Browser
Species Human (GRCh38)
Location 9:133356537-133356559
Sequence CCGCTCGCAGAACCTGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061840577_1061840589 27 Left 1061840577 9:133356537-133356559 CCGGCTCCAGGTTCTGCGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 91
Right 1061840589 9:133356587-133356609 TCGGCCATGAGCGAGTTGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1061840577_1061840588 26 Left 1061840577 9:133356537-133356559 CCGGCTCCAGGTTCTGCGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 91
Right 1061840588 9:133356586-133356608 GTCGGCCATGAGCGAGTTGCCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1061840577_1061840586 8 Left 1061840577 9:133356537-133356559 CCGGCTCCAGGTTCTGCGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 91
Right 1061840586 9:133356568-133356590 GGGCTGCTCCGCGGGCGCGTCGG 0: 1
1: 0
2: 0
3: 14
4: 113
1061840577_1061840583 0 Left 1061840577 9:133356537-133356559 CCGGCTCCAGGTTCTGCGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 91
Right 1061840583 9:133356560-133356582 CTTCCGCCGGGCTGCTCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 95
1061840577_1061840582 -1 Left 1061840577 9:133356537-133356559 CCGGCTCCAGGTTCTGCGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 91
Right 1061840582 9:133356559-133356581 GCTTCCGCCGGGCTGCTCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061840577 Original CRISPR CCGCTCGCAGAACCTGGAGC CGG (reversed) Exonic
900147312 1:1163892-1163914 CAGCCCGGAGAAGCTGGAGCCGG + Intergenic
900984454 1:6065434-6065456 CAGCGCGCAGAGCCAGGAGCTGG + Intronic
901470173 1:9450557-9450579 GCGCACCCAGACCCTGGAGCAGG + Intergenic
904334347 1:29787268-29787290 ACCCTGGCAGAGCCTGGAGCAGG - Intergenic
910145664 1:84077889-84077911 CAGCTGGCAGAGCCTGGGGCGGG - Intergenic
911043291 1:93608659-93608681 TCCCTAGCAGACCCTGGAGCTGG - Intronic
915490655 1:156248320-156248342 CTGCTGGGAGAACCTGGAACGGG - Intergenic
920259287 1:204677995-204678017 TCGCACGGAGAACTTGGAGCTGG - Intronic
922193680 1:223341419-223341441 CCGCCAGCAGAGCCTGGAGAGGG + Intronic
1064631636 10:17320037-17320059 CCTCTCACAGAGCCTGGTGCAGG + Exonic
1067078390 10:43200795-43200817 TCTCTCGCAGTTCCTGGAGCTGG + Exonic
1073772746 10:106753197-106753219 CAGTTTGCAGAACCTGGAGAAGG + Intronic
1074234180 10:111568259-111568281 CCACTCTCAGAAACTGGTGCAGG + Intergenic
1077374506 11:2199246-2199268 CAGCTAGCGGAGCCTGGAGCAGG + Intergenic
1078066275 11:8081334-8081356 CCGCTCGCAGAGCCAGCAGCCGG + Intronic
1078413602 11:11147611-11147633 CGGGTCCCAGAACCTGGAGCAGG - Intergenic
1083893895 11:65610858-65610880 CAGCTGGCAGAGCCAGGAGCGGG - Intronic
1084290148 11:68159294-68159316 GCGCTGGCAGAATCTGCAGCAGG - Intronic
1085475161 11:76784415-76784437 CGGCTCACAGGACCCGGAGCTGG + Intronic
1096460799 12:51820706-51820728 CCGCGGGCAGATCCTGCAGCGGG - Intergenic
1097078935 12:56415361-56415383 CTGCTAGAAGAAACTGGAGCTGG + Intergenic
1101873124 12:108581681-108581703 CCGCATGCAGCGCCTGGAGCAGG + Intergenic
1102171029 12:110842653-110842675 CCGCTGGGAGAACTTGGGGCAGG - Intergenic
1103579375 12:121902996-121903018 CCACTTGCAGACCCTGGAGAGGG - Exonic
1104446644 12:128839426-128839448 CCGCTCTCAGTTCCTGGAGTCGG + Intergenic
1111956021 13:94759292-94759314 CCGCCCCCAGAGCCAGGAGCAGG + Intergenic
1113483851 13:110640662-110640684 CTGCTCGCAGACCCTGGGCCAGG - Intergenic
1119865027 14:77966266-77966288 CGCCTGGCTGAACCTGGAGCCGG - Intergenic
1122302806 14:100740724-100740746 CCCCGTGCAGCACCTGGAGCAGG + Intergenic
1122901040 14:104782468-104782490 CAGCTCACAGAACCTGGGGCTGG - Intronic
1128308270 15:66614190-66614212 CAGCTCCCTGCACCTGGAGCTGG + Intronic
1128784418 15:70384222-70384244 CCCCTTGCAGGGCCTGGAGCGGG + Intergenic
1132604332 16:787465-787487 CTGGTGGCAGAACCTGGAGTGGG + Exonic
1132789608 16:1678347-1678369 CCCCGCGCCGCACCTGGAGCCGG - Exonic
1141164033 16:81648345-81648367 CCTCTGGCAGAAGCTGCAGCTGG + Intronic
1142668976 17:1478708-1478730 GAGCCCGCTGAACCTGGAGCAGG - Exonic
1147161739 17:38572697-38572719 CCGGACGCAGGACCTGGGGCTGG - Intronic
1148558433 17:48592391-48592413 CCGCTACCAGACCCTGGAGCTGG - Exonic
1148561273 17:48608039-48608061 CCGCTACCAGACCCTGGAGCTGG - Exonic
1148562368 17:48613450-48613472 CCGCTACCAGACCCTGGAGCTGG - Exonic
1150610376 17:66728453-66728475 CTGCTCGCACAAGGTGGAGCTGG - Intronic
1151875831 17:76867963-76867985 CCGCTCACAGAGCCAGGCGCAGG - Intergenic
1152724981 17:81940757-81940779 TCCCTCGCAGAGCCTGGAGCTGG + Exonic
1153665002 18:7360620-7360642 CGGCTGGCAGAGGCTGGAGCTGG + Intergenic
1154194151 18:12253900-12253922 CGGCTCGCTGAGCCTGGGGCTGG + Intergenic
1154349654 18:13572368-13572390 CCGATCACTGACCCTGGAGCAGG - Intronic
1162138687 19:8572114-8572136 CTCCACGCAGAAGCTGGAGCTGG + Intronic
1162805564 19:13136377-13136399 CCCCTCTGAGAAGCTGGAGCTGG + Exonic
1163243180 19:16076643-16076665 CCGCGCGCAGGGCCTGCAGCGGG + Intronic
1163568381 19:18065405-18065427 CCCCTTGCAGACCCTGGAGAAGG - Intronic
1163820609 19:19494466-19494488 CCTCTTGCAGAACCTGGGCCAGG - Intronic
1167567900 19:50268253-50268275 CCGCAAGCAGGAGCTGGAGCTGG + Exonic
925291046 2:2748917-2748939 CAGCTCTCAGAACCAGGGGCAGG + Intergenic
925317880 2:2939273-2939295 CTGCCTGCAGAACCTGGAGCGGG - Intergenic
925465526 2:4104749-4104771 CCGCTCTGAGAATCAGGAGCAGG - Intergenic
925730761 2:6918052-6918074 CCGCCCGCAGACCCTGGGGCTGG + Intronic
930608478 2:53516408-53516430 CATCTAGAAGAACCTGGAGCAGG + Intergenic
934774288 2:96927322-96927344 CTGCTCCCAGAGCCAGGAGCAGG + Intronic
937709373 2:124961409-124961431 CCCCTCGCAGGACCTGAACCAGG - Intergenic
941448397 2:165629278-165629300 CTGTACGCAGAACCTGAAGCAGG - Intronic
946702245 2:222424940-222424962 CCGCTCGCAGCGGCGGGAGCCGG - Intronic
1168891982 20:1300697-1300719 CCGCTCACCGGTCCTGGAGCCGG - Exonic
1171255874 20:23688750-23688772 TGGCTCGCAGCACCTGCAGCGGG + Exonic
1173516227 20:43667228-43667250 CCGCCGGCAGAGCCCGGAGCGGG - Exonic
1173594037 20:44247502-44247524 CAGCTCGCAGAAGGTAGAGCCGG + Exonic
1174385679 20:50187447-50187469 CTGCCCTCAGAACCTAGAGCCGG - Intergenic
1176119602 20:63448384-63448406 CCGTGCTCAGAACCAGGAGCCGG + Intronic
1180049092 21:45323246-45323268 GCGGGCCCAGAACCTGGAGCTGG + Intergenic
1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG + Intergenic
1185267797 22:49913603-49913625 CCACTGGCAAGACCTGGAGCAGG - Exonic
951521788 3:23617096-23617118 CCCCTTGCAGAACCTGGAGATGG + Intergenic
959109499 3:102105195-102105217 CAGCTCACAGAAACTGGAGCAGG - Intronic
960937549 3:122912955-122912977 CAGCTCGCAGTCCCGGGAGCAGG + Exonic
961326597 3:126112753-126112775 CCGCCCGCAGACCCTGGGGCAGG + Intronic
961353918 3:126321968-126321990 CAGCTGCCAGAACCTGGAGGTGG - Intergenic
968691251 4:1991595-1991617 AGGCTCGCTTAACCTGGAGCTGG - Exonic
972841423 4:42933982-42934004 ATGCAGGCAGAACCTGGAGCAGG + Intronic
974055164 4:56976973-56976995 CCGCGAGCAGTACCTGGAGCTGG - Exonic
974877722 4:67718178-67718200 CCACTGGCAGAGACTGGAGCCGG + Intergenic
986779139 5:11048135-11048157 GAGCTCCCAGAACCTGGAACTGG + Intronic
993815976 5:92546326-92546348 CTGCTAGCAGAATCTGCAGCAGG + Intergenic
999288300 5:150407179-150407201 CACCTCCCAGAACCTGCAGCTGG - Exonic
1002182813 5:177440330-177440352 CACCACGCAGAGCCTGGAGCTGG - Intronic
1002381534 5:178832767-178832789 CCGCTTGGAGGACCTGGAGAAGG - Intergenic
1002773494 6:308951-308973 GCGCTCACAGAACCTGGAGGAGG - Intronic
1006304768 6:33212306-33212328 TGGCTCGCTGACCCTGGAGCTGG + Exonic
1007176322 6:39900156-39900178 CAGCTCGGAGAAGCTGAAGCTGG - Exonic
1008109476 6:47477607-47477629 CCGCTCGCTGCACCTGGACGCGG + Intergenic
1008814965 6:55554371-55554393 CCACTTGCAGAATATGGAGCTGG + Intronic
1009418874 6:63443350-63443372 GGGCTGGCAGAAGCTGGAGCTGG - Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013289776 6:108709953-108709975 CCGCCCGCTGAACCTCCAGCAGG + Intergenic
1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG + Intergenic
1019715757 7:2538563-2538585 CCGCGCCCAGGGCCTGGAGCTGG - Exonic
1022095957 7:27142017-27142039 GCGCTACCAGACCCTGGAGCTGG - Exonic
1024080785 7:45853541-45853563 CCGCTGGCACCATCTGGAGCAGG - Intergenic
1024318789 7:48045164-48045186 CCTGTCCCAGGACCTGGAGCAGG - Intronic
1024570603 7:50719966-50719988 CCGCTCCCAGCAGCTGGAGTGGG - Intronic
1025003356 7:55336797-55336819 CCCCTCGCAAGACCTGCAGCAGG + Intergenic
1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG + Intergenic
1042389169 8:68213358-68213380 CCCCTCCCAGAACCTGGAAAGGG + Intronic
1047445541 8:124915917-124915939 CCCATCCCAGAACCTGGTGCAGG + Intergenic
1048867409 8:138771061-138771083 CTGCTCGCAGAGCCCCGAGCTGG + Intronic
1057231418 9:93323872-93323894 CAGCTCACAGAACCTTGAGCTGG - Intronic
1057236678 9:93366751-93366773 CAGCTCACAGAACCTTGAGCTGG + Intergenic
1057432141 9:95004685-95004707 CCGCTCGCAGGGCGCGGAGCCGG + Intronic
1059471221 9:114505691-114505713 CCGCCGGCAGAGCCGGGAGCGGG + Intergenic
1061840577 9:133356537-133356559 CCGCTCGCAGAACCTGGAGCCGG - Exonic