ID: 1061841094

View in Genome Browser
Species Human (GRCh38)
Location 9:133359042-133359064
Sequence GCCAGTGTGTTAGCTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061841087_1061841094 23 Left 1061841087 9:133358996-133359018 CCTTGCAGGCACAAGGGCTGCCA 0: 1
1: 0
2: 4
3: 15
4: 220
Right 1061841094 9:133359042-133359064 GCCAGTGTGTTAGCTGCTCAGGG No data
1061841090_1061841094 3 Left 1061841090 9:133359016-133359038 CCAGCCTGAGGCTTGGACTTTTT 0: 1
1: 1
2: 1
3: 25
4: 267
Right 1061841094 9:133359042-133359064 GCCAGTGTGTTAGCTGCTCAGGG No data
1061841091_1061841094 -1 Left 1061841091 9:133359020-133359042 CCTGAGGCTTGGACTTTTTCCAG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1061841094 9:133359042-133359064 GCCAGTGTGTTAGCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061841094 Original CRISPR GCCAGTGTGTTAGCTGCTCA GGG Intronic
No off target data available for this crispr