ID: 1061841571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:133361399-133361421 |
| Sequence | CTCGCTCACTGGCATCCTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 138 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 130} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1061841567_1061841571 | -9 | Left | 1061841567 | 9:133361385-133361407 | CCTAGAGAAGTAACCTCGCTCAC | 0: 1 1: 0 2: 0 3: 6 4: 76 |
||
| Right | 1061841571 | 9:133361399-133361421 | CTCGCTCACTGGCATCCTGAGGG | 0: 1 1: 0 2: 1 3: 6 4: 130 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1061841571 | Original CRISPR | CTCGCTCACTGGCATCCTGA GGG | Intergenic | ||