ID: 1061841571

View in Genome Browser
Species Human (GRCh38)
Location 9:133361399-133361421
Sequence CTCGCTCACTGGCATCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061841567_1061841571 -9 Left 1061841567 9:133361385-133361407 CCTAGAGAAGTAACCTCGCTCAC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1061841571 9:133361399-133361421 CTCGCTCACTGGCATCCTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061841571 Original CRISPR CTCGCTCACTGGCATCCTGA GGG Intergenic