ID: 1061842767

View in Genome Browser
Species Human (GRCh38)
Location 9:133369205-133369227
Sequence GTGTGCAGAACTGACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061842767_1061842771 12 Left 1061842767 9:133369205-133369227 CCTGCAGTGTCAGTTCTGCACAC 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1061842771 9:133369240-133369262 TTTGACTCCACGGAAGTGATGGG No data
1061842767_1061842768 2 Left 1061842767 9:133369205-133369227 CCTGCAGTGTCAGTTCTGCACAC 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1061842768 9:133369230-133369252 TTACTCAGCCTTTGACTCCACGG No data
1061842767_1061842770 11 Left 1061842767 9:133369205-133369227 CCTGCAGTGTCAGTTCTGCACAC 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1061842770 9:133369239-133369261 CTTTGACTCCACGGAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061842767 Original CRISPR GTGTGCAGAACTGACACTGC AGG (reversed) Intronic
901836059 1:11925135-11925157 GTCTGCAGAGGTGACACTGAAGG - Intronic
906811568 1:48832339-48832361 CTGTGCAGAATTCACACGGCAGG - Intronic
918488414 1:185054092-185054114 GTGTCTAGAAGTGAAACTGCCGG + Intronic
920588407 1:207191978-207192000 TTGGGCATAAGTGACACTGCAGG - Intergenic
921409439 1:214819398-214819420 ATGCCCAGAAGTGACACTGCTGG + Intergenic
922348326 1:224715669-224715691 GTGTGCAGAGATCACACGGCGGG + Intronic
923722749 1:236481359-236481381 GTGTGCATTTGTGACACTGCTGG - Intronic
924162474 1:241246896-241246918 TTGCGCAGAACTGAGAGTGCTGG + Intronic
1062884742 10:1007720-1007742 GTGTGCTGCACTGACGCTGGAGG + Intronic
1064646612 10:17465964-17465986 CTGAGCAGAACTGACAATTCAGG - Intergenic
1066347115 10:34598800-34598822 GTGTTCAGATCTGTAACTGCAGG - Intronic
1067221774 10:44349031-44349053 GAGTGCAGGACTCACAGTGCGGG + Intergenic
1068774790 10:60857974-60857996 GTGTGCAGAAATCACATGGCAGG + Intergenic
1069162690 10:65110295-65110317 GTATGAAGACCTGACACTGAGGG + Intergenic
1069632117 10:69903275-69903297 GTGTGCAGGTTTCACACTGCTGG + Intronic
1070782092 10:79143568-79143590 GTGTGCAGAGATGACAGTGGAGG + Intronic
1071241569 10:83711715-83711737 GTGTGGAGATCTAACACAGCTGG + Intergenic
1072070521 10:91910911-91910933 GTGTGCTATACTTACACTGCAGG + Intergenic
1075193118 10:120329681-120329703 ATGAGCAGAACTGACAGAGCAGG + Intergenic
1079240328 11:18717931-18717953 GAGTGCAGAGCTCACAGTGCTGG - Exonic
1080990964 11:37534148-37534170 CTTTGGAAAACTGACACTGCAGG - Intergenic
1082988995 11:59191297-59191319 CTGGTCAGAACTGACACTGAGGG + Intronic
1084042250 11:66548969-66548991 GTGGGCAGAACTGTCCATGCTGG - Intronic
1085250360 11:75139559-75139581 GTGTGCAGATCTGGCGCTGCAGG + Intronic
1085325175 11:75601105-75601127 GTGGGCAGCACTGACAAAGCTGG + Intronic
1088749997 11:112835321-112835343 GTGTGTGGAAATGAGACTGCAGG - Intergenic
1089061865 11:115632306-115632328 GTGTGCAGAAGACACACTGTAGG - Intergenic
1089682677 11:120128104-120128126 GTGGGCAGAACAGACATTGGAGG + Intronic
1090583894 11:128188942-128188964 GTGTGCCAAAGTGACCCTGCTGG - Intergenic
1091290653 11:134437703-134437725 TGGTGCAGAGCTGGCACTGCAGG + Intergenic
1092114018 12:5985617-5985639 ATGTGCAGATCTGACAGGGCTGG + Exonic
1093431819 12:19093364-19093386 TTCTGAAGAACTGCCACTGCCGG + Intergenic
1098141246 12:67452192-67452214 GTATGCAGAAGTGAAAATGCTGG + Intergenic
1098926242 12:76351997-76352019 GTGTGCTGTACTTACACTGCAGG + Exonic
1101551465 12:105766426-105766448 CAGTGCACAACTGACACAGCTGG + Intergenic
1102555744 12:113725343-113725365 CTGGGCTGACCTGACACTGCTGG + Intergenic
1104405741 12:128515264-128515286 GGGTGCAGACCTGTCAATGCAGG - Intronic
1105579982 13:21686514-21686536 GTCTGCAAAAGTGACACTGGAGG + Intronic
1105756117 13:23466182-23466204 GAGTGAAGAACTGACAGTGAAGG - Intergenic
1106118403 13:26837267-26837289 GTGGGCAAAACTCACCCTGCTGG - Intergenic
1109001749 13:56813490-56813512 GTCTGCAGGAGTGACACTGCAGG + Intergenic
1111366135 13:87248211-87248233 GTTTGCAGAATCGACACTGGAGG - Intergenic
1112399456 13:99063273-99063295 GTGAGCCAAAATGACACTGCTGG + Intronic
1114749074 14:25183240-25183262 GGGTGCAGTACTGACATTGTTGG + Intergenic
1115238475 14:31231548-31231570 GAGTGCAGTACAGTCACTGCTGG - Intergenic
1117299759 14:54413012-54413034 GCCTTCAGAACTGACACTGTTGG - Intronic
1117660766 14:58001924-58001946 GTGTTCACAACTGAAGCTGCAGG + Exonic
1119804779 14:77475566-77475588 GGTTGCTGAACAGACACTGCAGG - Exonic
1119962033 14:78869643-78869665 ATGTGCAGAACTTACCCTGTTGG - Intronic
1124551709 15:30687072-30687094 GTTTGCAGAACTAGCACTTCAGG + Intronic
1124632010 15:31343399-31343421 GTGTGCAGACTTAAGACTGCAGG - Intronic
1124679541 15:31718593-31718615 GTTTGCAGAACTAGCACTTCAGG - Intronic
1125056261 15:35361099-35361121 GTGTCCGGAACTGAGACTACGGG + Intronic
1126255047 15:46615524-46615546 GTGTGCAGAAGTAACACTGGAGG - Intergenic
1129514526 15:76148901-76148923 GATTGCAGAACTGAAGCTGCCGG + Intronic
1133282814 16:4676748-4676770 GTGAGCAGGACTGGCACTGTGGG + Intronic
1138700315 16:58855897-58855919 GTGTGCAGAAACGACTCAGCAGG + Intergenic
1142116899 16:88361981-88362003 ATGAGCAGAACTGACAATTCAGG - Intergenic
1146628511 17:34453254-34453276 GTCTGCAGGACTTTCACTGCTGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152399707 17:80058487-80058509 GTCTGCAGAGCCGCCACTGCGGG - Exonic
1152846100 17:82600691-82600713 GTGGGCAGAACAGAGACTGCTGG - Intronic
1153748470 18:8205306-8205328 GTTTGGAGAACTCACATTGCAGG - Intronic
1153949395 18:10045509-10045531 GTGTGCCGCACTGACTCTCCAGG + Intergenic
1155549041 18:26945777-26945799 ATGTCCAGAAGTGACATTGCTGG + Intronic
1156483817 18:37452318-37452340 CTGTGCAGAAATGACAGTCCTGG - Intronic
1156801527 18:41120755-41120777 GGCAGCAGAAGTGACACTGCCGG - Intergenic
1157799411 18:50606825-50606847 GTGAGCAGAAGTGACACTTTTGG + Intronic
1158842978 18:61408282-61408304 GGGTTCAGAACTGACAGTACTGG + Intronic
1159001038 18:62975336-62975358 ATTTGCAGAACTGGCACTGATGG + Intronic
1161978601 19:7619370-7619392 GAGTCCAGAACTGGCTCTGCGGG + Intergenic
1162796700 19:13090845-13090867 GTGCCCAGAACTGGCACTGAGGG + Intronic
1163361083 19:16846828-16846850 GTGTGCAGACAGGACCCTGCGGG + Intronic
1163738881 19:18998724-18998746 GTGGGCAGAAGTGTCTCTGCAGG + Intronic
1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG + Intronic
1163836853 19:19580184-19580206 GTGTCTGGAACTGACAGTGCCGG + Intronic
1165252985 19:34555499-34555521 GGTTGCAGAAAGGACACTGCAGG + Intergenic
1167383645 19:49152040-49152062 GATAGCAGAACTGACAGTGCTGG + Exonic
1167619684 19:50553860-50553882 GTGTGCAGAACGGAGAGTGGGGG - Intronic
929203662 2:39265524-39265546 GTATGCACAAATGAAACTGCTGG + Intronic
929709933 2:44256430-44256452 GTGTGCAGGGCTGCAACTGCTGG - Intergenic
932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG + Intronic
933463973 2:82626550-82626572 GTGTGCAGAAATCACATGGCAGG + Intergenic
936005408 2:108882835-108882857 GTGTGCAGATCTGGGACTGCTGG + Intronic
938540702 2:132281525-132281547 GTAAGCAGAACTGGCACTGTGGG - Intergenic
939586189 2:144008893-144008915 GTGGGCAGAAATCAGACTGCAGG + Intronic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
940117774 2:150228053-150228075 GTGTGCAGAACAGAAAAAGCAGG + Intergenic
940795077 2:158069349-158069371 GTGTGCAGAAGAGATATTGCAGG + Intronic
942600550 2:177636652-177636674 AAGTGAAGAACTGAAACTGCAGG + Intronic
944532536 2:200681386-200681408 GGGTGCAGAACCCACACTGGGGG - Intergenic
947095785 2:226565003-226565025 GAGGGCAGAACTGTCACTGGTGG - Intergenic
1171869613 20:30514526-30514548 GTAAGCAGAACTGGCACTGTGGG - Intergenic
1172742624 20:37180844-37180866 GTGTGGAGAACAGACCATGCAGG - Intronic
1176184432 20:63770674-63770696 TTGTGCAGAATTGCCACGGCCGG + Intronic
1176549676 21:8215747-8215769 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1176557567 21:8259976-8259998 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1176568601 21:8398781-8398803 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1176576512 21:8443010-8443032 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1181038536 22:20181402-20181424 CTGTGCAGCTCTGCCACTGCTGG - Intergenic
1181661141 22:24349857-24349879 GTGTCAAGAACAGACACTGAGGG - Intronic
1203254562 22_KI270733v1_random:132068-132090 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1203262618 22_KI270733v1_random:177147-177169 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
949493356 3:4609865-4609887 CTGAGCAGAGCTGTCACTGCTGG - Intronic
950386579 3:12664759-12664781 GTGTCTAGAAGTGAAACTGCCGG - Intergenic
950879075 3:16307282-16307304 GTGTGAACCACTGACACAGCAGG - Intronic
953118170 3:40013315-40013337 GTGTGCAGAATGGTCTCTGCTGG + Intronic
956817755 3:72923929-72923951 GTCTGCATAAATGCCACTGCTGG - Intronic
958572830 3:95910844-95910866 TTGTGCACAACTTACACTACTGG + Intergenic
959063881 3:101638443-101638465 GGTTGCAGAAAGGACACTGCAGG - Intergenic
959598310 3:108151748-108151770 GTGTTCAGAACTGCTACTGATGG + Intergenic
960440888 3:117687204-117687226 CTTTCCAGAACTGAGACTGCTGG + Intergenic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
967308331 3:188081770-188081792 GTGTGAGGCACTGACAATGCTGG + Intergenic
968621588 4:1605675-1605697 GTGGGCAGAGCTCACCCTGCAGG - Intergenic
969447683 4:7254874-7254896 GAGTGCAGATCTGACTCAGCAGG + Intronic
976389961 4:84497505-84497527 GTGGGCAGAACAGGCACGGCAGG + Intronic
977689374 4:99888330-99888352 GTGTGCACAATTGACACCACTGG - Intronic
978738696 4:112113442-112113464 GTGTCCAGAACTGTAGCTGCAGG - Intergenic
981280916 4:142957313-142957335 GTTAGCAGAACTCACACTGAAGG - Intergenic
983558753 4:169080747-169080769 GTGCGGAGAACTTACACTCCTGG - Intergenic
985383444 4:189420091-189420113 GTGTGCAGAAGAGAAACTGGCGG - Intergenic
985751859 5:1684654-1684676 GTGACCAGAACTGACACTTCCGG + Intergenic
987569886 5:19643314-19643336 TTATCCAGAACTGAAACTGCTGG - Intronic
991116669 5:62963149-62963171 GTGTGCAGAAGTCACATGGCAGG + Intergenic
993347970 5:86808934-86808956 GTGTCAAGAACTTACACTGGGGG + Intergenic
995556622 5:113336412-113336434 GTGTGCAGGAGACACACTGCAGG + Intronic
995797985 5:115962041-115962063 GCGTTCAGAAATGACCCTGCAGG - Intergenic
996900295 5:128537065-128537087 GTGTGCAGAGCTCGCGCTGCGGG - Intronic
997628526 5:135348535-135348557 GTGTGAAGTCCTGAGACTGCTGG - Intronic
997646244 5:135483914-135483936 GTGATCAGAGCTGACCCTGCTGG + Intergenic
997761795 5:136455945-136455967 GTGGTCAAAACAGACACTGCTGG + Intergenic
999522931 5:152371058-152371080 GTGTTCAGAACTGGCCTTGCAGG + Intergenic
1001234543 5:170018661-170018683 ATTTGCAGAGCAGACACTGCAGG + Intronic
1001579383 5:172788633-172788655 GTGTGCAGCCTGGACACTGCAGG + Intergenic
1003164153 6:3661532-3661554 GTGTGCAGGACGGACAGTGCAGG - Intergenic
1009525898 6:64745978-64746000 GAATGCAGAACAGGCACTGCTGG + Intronic
1011263140 6:85489163-85489185 CTGTGCAGGAGTGACTCTGCAGG + Intronic
1012110767 6:95229397-95229419 GTTTGAAGAACTTACAGTGCGGG + Intergenic
1015443348 6:133272955-133272977 GTAAGCAGAACTGGCACTGTGGG + Intronic
1015512257 6:134049450-134049472 TGGTGCAGAACTGACCCTGGTGG - Intronic
1017021648 6:150144089-150144111 GTGTGCAGCTCTGATAATGCAGG - Intronic
1017252560 6:152297010-152297032 GTGTACAGAACTGATACTTCTGG - Intronic
1017492212 6:154954755-154954777 GTGTGCCAAACTCACACTGTGGG + Intronic
1017991645 6:159494397-159494419 GTGACCTGAACTGACATTGCTGG + Intergenic
1019599007 7:1872183-1872205 GTGTGCATGTCTGACCCTGCAGG - Intronic
1020469720 7:8522314-8522336 GTGTGCAGTGTTGACAATGCAGG + Intronic
1023821094 7:43980943-43980965 GTGTGCAGAAGGGACTCTGCAGG - Intergenic
1026030609 7:66789873-66789895 GTGTGCAGAACTGAGAAGGCTGG - Intronic
1028827084 7:95286234-95286256 GTCTGCTGAACTGGTACTGCTGG - Exonic
1029463685 7:100711694-100711716 TTCTGCAGAACTGCCACTGAGGG - Intergenic
1029550797 7:101236183-101236205 GTGTCCAGAAGGGACACTGGAGG - Intronic
1029749368 7:102534382-102534404 TTGTGCAGAAGGGACTCTGCAGG - Intergenic
1029767313 7:102633487-102633509 GTGTGCAGAAGGGACTCTGCAGG - Intronic
1031520526 7:122759679-122759701 GTATTCAGAAATGAGACTGCAGG + Intronic
1033549071 7:142429252-142429274 CTGTGAAGAAATGACATTGCTGG - Intergenic
1035363098 7:158326298-158326320 GGATGAAGAACTGGCACTGCAGG - Intronic
1037822332 8:22141008-22141030 GTCACCAGACCTGACACTGCTGG + Intronic
1043639598 8:82435237-82435259 GTCTGCAGCACTTCCACTGCTGG + Intergenic
1044516232 8:93142015-93142037 GAGTACAGAACAGACCCTGCTGG + Intronic
1045022611 8:98057354-98057376 CTGTGGAGAAGTGACACTTCTGG + Intergenic
1048758467 8:137765759-137765781 GTGAGCATAGCTGGCACTGCAGG + Intergenic
1049176045 8:141193346-141193368 GGGCTCAGAACTGACACTGGAGG - Intronic
1049433607 8:142576319-142576341 CTGGGCAGAACTCTCACTGCAGG + Intergenic
1049601077 8:143507968-143507990 GTGGGCAGAGCTGGCACTGTGGG - Intronic
1053053039 9:34977231-34977253 AGGAGCAGACCTGACACTGCAGG - Exonic
1055887449 9:81080665-81080687 GTGTGAAGAAAGGACACTGAAGG + Intergenic
1057592024 9:96381076-96381098 GGGTGGAGAACTGACAGTACTGG - Intronic
1057726449 9:97571936-97571958 GTGTGCAGGACTGAGGCTCCAGG + Intronic
1060999515 9:127895225-127895247 GGGTGCTGGACAGACACTGCAGG + Intronic
1061842767 9:133369205-133369227 GTGTGCAGAACTGACACTGCAGG - Intronic
1062078027 9:134602703-134602725 GTTTGCAGAAATTCCACTGCCGG - Intergenic
1062302966 9:135885928-135885950 GAGGGCAGAACTGCCACAGCAGG - Intronic
1062648055 9:137560085-137560107 GTGTGCCCAACAGACAATGCTGG + Intronic
1203470963 Un_GL000220v1:115212-115234 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1203478784 Un_GL000220v1:159184-159206 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1186097788 X:6120907-6120929 GAGAGTAGAACTGACCCTGCAGG + Intronic
1187375418 X:18748662-18748684 GTGTCCAGAACAAACACTGGTGG + Intronic
1188402448 X:29762902-29762924 GTGTGCAGGAGCGACACTGAGGG - Intronic
1188733470 X:33682313-33682335 GTGTGAAGAACATACACTGGAGG - Intergenic
1191677721 X:63809294-63809316 GTCTGCAAAATTGCCACTGCTGG - Intergenic
1195372232 X:104188170-104188192 GCTTGCAGAACTGACCATGCTGG - Exonic