ID: 1061843656

View in Genome Browser
Species Human (GRCh38)
Location 9:133375411-133375433
Sequence GTGCTGTGGCTTCCTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061843647_1061843656 18 Left 1061843647 9:133375370-133375392 CCCCAAGAGTCCAGCACATCTGG 0: 1
1: 0
2: 1
3: 24
4: 135
Right 1061843656 9:133375411-133375433 GTGCTGTGGCTTCCTGTAGCTGG No data
1061843649_1061843656 17 Left 1061843649 9:133375371-133375393 CCCAAGAGTCCAGCACATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1061843656 9:133375411-133375433 GTGCTGTGGCTTCCTGTAGCTGG No data
1061843652_1061843656 8 Left 1061843652 9:133375380-133375402 CCAGCACATCTGGGAAAGAGAAA 0: 1
1: 0
2: 2
3: 27
4: 310
Right 1061843656 9:133375411-133375433 GTGCTGTGGCTTCCTGTAGCTGG No data
1061843651_1061843656 16 Left 1061843651 9:133375372-133375394 CCAAGAGTCCAGCACATCTGGGA 0: 1
1: 0
2: 5
3: 13
4: 193
Right 1061843656 9:133375411-133375433 GTGCTGTGGCTTCCTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061843656 Original CRISPR GTGCTGTGGCTTCCTGTAGC TGG Intronic