ID: 1061844220

View in Genome Browser
Species Human (GRCh38)
Location 9:133377730-133377752
Sequence ATTTTTCCACAGATGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 2, 1: 13, 2: 48, 3: 162, 4: 590}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061844213_1061844220 17 Left 1061844213 9:133377690-133377712 CCAACCTTTTTGGCACAAGGGAC 0: 25
1: 1034
2: 1739
3: 1410
4: 1012
Right 1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG 0: 2
1: 13
2: 48
3: 162
4: 590
1061844210_1061844220 19 Left 1061844210 9:133377688-133377710 CCCCAACCTTTTTGGCACAAGGG 0: 21
1: 1062
2: 1613
3: 1396
4: 1914
Right 1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG 0: 2
1: 13
2: 48
3: 162
4: 590
1061844212_1061844220 18 Left 1061844212 9:133377689-133377711 CCCAACCTTTTTGGCACAAGGGA 0: 21
1: 1080
2: 1642
3: 1375
4: 1021
Right 1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG 0: 2
1: 13
2: 48
3: 162
4: 590
1061844214_1061844220 13 Left 1061844214 9:133377694-133377716 CCTTTTTGGCACAAGGGACCAGT 0: 9
1: 468
2: 891
3: 1268
4: 1095
Right 1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG 0: 2
1: 13
2: 48
3: 162
4: 590
1061844216_1061844220 -5 Left 1061844216 9:133377712-133377734 CCAGTTTTGTGGAAGACAATTTT 0: 288
1: 601
2: 873
3: 819
4: 752
Right 1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG 0: 2
1: 13
2: 48
3: 162
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061844220 Original CRISPR ATTTTTCCACAGATGGAGGC GGG Intronic
901080503 1:6581165-6581187 AGTTTCCCACAGAGGGAGGAGGG - Exonic
901304535 1:8223161-8223183 ATTTTTCCACAGCCGGGGGCTGG - Intergenic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
902416762 1:16244349-16244371 ATTTTCCCACAGCTGAGGGCTGG + Intergenic
902592736 1:17486637-17486659 ATTTTTCCACAGACTGAGTCGGG - Intergenic
902703541 1:18189412-18189434 ATTTTTCCACAGACCAGGGCAGG + Intronic
903223806 1:21883892-21883914 ATTTTCCCAAAGATAGAGGCAGG - Intronic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
903842083 1:26250432-26250454 ATTTTTCCACAGACGATGGTTGG - Intronic
903917683 1:26776130-26776152 ATTTGACCACAGATTCAGGCTGG - Intronic
904203467 1:28836909-28836931 AGTTTTCCATCGATGGGGGCAGG + Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905765427 1:40596234-40596256 ATTTTTCCACGGATGGCAGGAGG - Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
908247693 1:62241110-62241132 ATTCTTTCACAGAAGCAGGCAGG + Intronic
908588718 1:65604880-65604902 ATTTTTCCACTAATGGGGGATGG - Intronic
908918454 1:69160940-69160962 ATTTACTCACATATGGAGGCTGG - Intergenic
909135143 1:71789115-71789137 AGTTATACACATATGGAGGCTGG + Intronic
909405140 1:75280778-75280800 ATCTTTCTTCACATGGAGGCAGG - Intronic
909423901 1:75499219-75499241 ATTTTTCCATGGATGGGGGCCGG + Intronic
909533000 1:76701765-76701787 ATTTTTCCATGGATGGGGGCAGG + Intergenic
909774498 1:79467091-79467113 ATTTACCCACATGTGGAGGCAGG + Intergenic
909966359 1:81915645-81915667 ATTTTTGAACAGATATAGGCTGG + Intronic
910104885 1:83621341-83621363 ATTTGTCCACTGATGGAAACAGG - Intergenic
910411934 1:86955456-86955478 ATTTTTCCACAGGGGGTGGGCGG - Intronic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910621481 1:89260073-89260095 ATTTTTCCACAGAGGGTTGGCGG + Intronic
910687269 1:89930078-89930100 ATTTTTCCAGAAATGGGGGTTGG - Intronic
910824965 1:91397073-91397095 GTTTTTCCACAGATGGTTTCGGG - Intronic
910953775 1:92679241-92679263 ATTTCTCCACTTATGGGGGCTGG - Intronic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
912485518 1:110024481-110024503 ATATTCTCACAGTTGGAGGCTGG + Intergenic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
914506672 1:148295690-148295712 ATTTTTCCAAATATGCAGGGGGG - Intergenic
914753434 1:150550360-150550382 ACTTTTCCAGAGAGGGAGCCAGG + Intronic
915044763 1:153003095-153003117 ATATTTCCTGAGGTGGAGGCTGG - Exonic
915411445 1:155703968-155703990 ATTTTTACAGAGATGGGGTCTGG - Intronic
915685542 1:157628909-157628931 TATTTTTCACAGTTGGAGGCTGG + Intergenic
915924607 1:160006267-160006289 ATTTTTGTAGAGATGGAGTCTGG + Intergenic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916852908 1:168721860-168721882 ATTCTTACCCAGATGCAGGCAGG - Intronic
916874770 1:168957664-168957686 ACTTTTCCACAGATGGGCTCAGG + Intergenic
917031871 1:170701987-170702009 ATTTTTCCATGGATGGGGGAAGG + Intronic
918234487 1:182566340-182566362 TCTTTTCCACAAATGGAGGTGGG - Intergenic
918401876 1:184171652-184171674 ATTTTTCCATAGCTGAAGACAGG - Intergenic
919527065 1:198666348-198666370 TTTTTTCCACACATGTAGGAAGG + Intronic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919921612 1:202169562-202169584 ACCTGTCCACTGATGGAGGCTGG - Intergenic
920149155 1:203890317-203890339 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
921091365 1:211847047-211847069 ATTATGCCAGAGCTGGAGGCAGG - Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921458010 1:215395117-215395139 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
921979002 1:221234697-221234719 ATTTTTCAACAGCTGGACTCTGG + Intergenic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922293257 1:224226818-224226840 ATTTTTCCACAGACAGGGTCAGG + Intergenic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
923491599 1:234488975-234488997 ATTTTGCCTCAGAAGCAGGCTGG - Intergenic
923512556 1:234665002-234665024 ATTTTTCCACGGTTGGGGGGTGG - Intergenic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
924650884 1:245926220-245926242 AGTTTTCAACAGATGGAATCTGG + Intronic
1063292350 10:4762201-4762223 AAGTTTTCCCAGATGGAGGCAGG - Intergenic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063604669 10:7512207-7512229 ATTTTTCCACAGACAGTGGAGGG + Intergenic
1063784274 10:9362873-9362895 ATTTCTCCACGGATGGGGGCGGG - Intergenic
1064062170 10:12147386-12147408 AATTTTCTATACATGGAGGCTGG + Intronic
1064178411 10:13095413-13095435 ATTTTTCCATGGATGGTGGTGGG + Intronic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1064921616 10:20525516-20525538 ATATTCCAGCAGATGGAGGCAGG - Intergenic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1066003131 10:31123138-31123160 TTTTTTCCCGAGATGGAGTCTGG - Intergenic
1066199465 10:33131279-33131301 ATTTTTCCACAGAGAGGGACAGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1066757895 10:38729358-38729380 AGTTTCCAAGAGATGGAGGCAGG + Intergenic
1067269362 10:44775868-44775890 ATTCTTCCAAAGCTGGAGGTTGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068064418 10:52110454-52110476 GTTTTTAGAAAGATGGAGGCAGG + Intronic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068383989 10:56299310-56299332 GTTTTTCCACAGACAGAGTCGGG - Intergenic
1068401303 10:56531174-56531196 AATTTTCCACAGATGTACGGTGG - Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068765543 10:60759225-60759247 ATTTTTCCATGGATGGAGGTGGG + Intergenic
1068861791 10:61855169-61855191 ATTTTTCCACAGACGTAGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1070695743 10:78561826-78561848 TTTCCTCCACAGCTGGAGGCAGG - Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1071501283 10:86206046-86206068 ATGCTGGCACAGATGGAGGCTGG - Intronic
1071981913 10:91011930-91011952 ATTTTTTCACAGATGTTGGAAGG - Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072332696 10:94369233-94369255 ATTTTTCCACAGATCAGGGTGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1075172392 10:120127829-120127851 ATTTTTCCCCTGCTGGAGCCAGG - Intergenic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076415072 10:130280223-130280245 ATTTTTCCACAGACCCAGGGTGG - Intergenic
1076466079 10:130682495-130682517 ATGTTTCCACTGGTGGAAGCAGG - Intergenic
1077505141 11:2926587-2926609 ATTTTTCCACGGATGTGGGTGGG + Intergenic
1077860846 11:6178480-6178502 ATTTTTCCACAGACAGGGGAAGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078611408 11:12822614-12822636 CTTTTTCCAGGGCTGGAGGCTGG + Intronic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080423637 11:32136402-32136424 AATATTCCACAGATGGATGGTGG + Intergenic
1080470231 11:32538353-32538375 ATTTTTCCATGGATGGGGGTCGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081262396 11:40976844-40976866 TTTTTTCCACAGACTGGGGCAGG + Intronic
1081281182 11:41210840-41210862 ATTCTTCCACTGATGGGGGTTGG + Intronic
1082708842 11:56527915-56527937 ATTTTTCCATGGATGGGGGTTGG + Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083139034 11:60706420-60706442 ATTTGTCCAGATATGCAGGCAGG + Intronic
1084281270 11:68096026-68096048 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1085293499 11:75417290-75417312 ATTTTTTAAGAGATGGAGTCTGG - Intronic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088185713 11:107166864-107166886 CTTTTTCCACAGATGTGGTCAGG + Intergenic
1089249175 11:117144956-117144978 ATTTTTCAACAAAAGGAGGAGGG - Intronic
1089330304 11:117684867-117684889 ATTGCTCCACAGAGGGAGGAAGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1090230969 11:125103346-125103368 GTTTTTCCACAGGGGGATGCAGG - Intronic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1091007953 11:131970719-131970741 TTTTTACCACAGATGCAGGGTGG + Intronic
1091074420 11:132601790-132601812 ATTTTTCTCCAAATGGAGTCAGG + Intronic
1091248984 11:134125624-134125646 ATCTTTCCATCGATGGATGCTGG + Intronic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092734293 12:11565526-11565548 ATTTTCCCACGGATGGGGGTTGG - Intergenic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093651698 12:21653420-21653442 ATTTTTCCACAGATGTGTGAGGG - Intronic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1093808438 12:23464538-23464560 AATTTTCCCCTGCTGGAGGCAGG + Intergenic
1094167445 12:27457042-27457064 ATTTTTCCACAGACAGTGGGAGG - Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1095053905 12:37578320-37578342 AGTTTTACAAAGATGGAGCCTGG - Intergenic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1095757328 12:45783525-45783547 GTTTTTCCACAGACTGTGGCAGG + Intronic
1096585207 12:52615492-52615514 ATTTGGCCAGAGTTGGAGGCCGG + Intronic
1096890024 12:54760339-54760361 AATTTTCCACAAATGGTGCCTGG + Intergenic
1097110562 12:56655001-56655023 ATTTTTCCATGGATGGGGGTGGG - Intergenic
1097824636 12:64162431-64162453 ATTTTTCCACAGATGATAGTGGG - Intergenic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099851005 12:88097407-88097429 ATTTTTCTTCACATGGTGGCCGG - Intronic
1100053667 12:90482889-90482911 ATTTTCCCAAAGTTGGAGGTGGG + Intergenic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100733641 12:97501773-97501795 ATTTCTCGACAGGTGGAGACAGG - Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101026428 12:100611552-100611574 GTTTTTCCACAGATTTGGGCGGG + Intronic
1101375565 12:104168413-104168435 ATTCTTCCACAGATGGGAGCAGG - Intergenic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1101861118 12:108483256-108483278 ATTTTTCCACGGACGGTGGGTGG - Intergenic
1102925333 12:116821695-116821717 ATTTTTCCACATGTGGAAGGAGG + Intronic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1103631857 12:122267989-122268011 AATTTAACACACATGGAGGCCGG + Intergenic
1103865386 12:124047741-124047763 GTTTTTCTGCAGATGGGGGCAGG - Intronic
1104257338 12:127151254-127151276 ATTTTTCCATAGACTGGGGCAGG + Intergenic
1105370419 13:19797280-19797302 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1105570576 13:21599119-21599141 GTTTCTCCACTGATGGAGGTGGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106523443 13:30518917-30518939 ATTTTTGTAGAGATGGGGGCTGG + Intronic
1107343236 13:39432166-39432188 ATTTCCTCACAGTTGGAGGCTGG - Intronic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1107505977 13:41033739-41033761 ATTTTTCCACAGAAGTTGGTGGG - Intronic
1107721887 13:43258081-43258103 ATGTTTCCACTGCTGGAGGCTGG - Intronic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1107895347 13:44956391-44956413 ATTTTTCCAAAGACAGAGGGTGG + Intronic
1108345866 13:49546434-49546456 ATTTTTCCACGGACCGAGGCGGG + Intronic
1108394988 13:49983190-49983212 ATTTTTTCTGAGATGGAGTCCGG - Intergenic
1108820431 13:54342703-54342725 ATTTGTCCATGGATGGGGGCAGG - Intergenic
1108845179 13:54669603-54669625 ATTTTTCCATGGATGGATGGTGG - Intergenic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110477075 13:75928610-75928632 ATTTTTCCATAGATGGCTGGGGG - Intergenic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1110849971 13:80233698-80233720 ATTTTTCCATGAATGGGGGCAGG + Intergenic
1111046414 13:82819769-82819791 ATTTTTCCTTGGATGGAGGGGGG - Intergenic
1111047655 13:82835670-82835692 ATTTTTTTAGAGATGGAGTCTGG - Intergenic
1112372040 13:98802632-98802654 AAATTTCCACTGAAGGAGGCTGG + Intronic
1112385318 13:98934072-98934094 ATTTTTGGAGAGATGGGGGCGGG + Intronic
1112581392 13:100679183-100679205 ATTTTTCCATGGATGGAGTTGGG - Intergenic
1113126316 13:106983222-106983244 ATTTTTCCACAAACTGGGGCTGG - Intergenic
1113252087 13:108464755-108464777 CTTTTTCAGCAGATGGATGCAGG + Intergenic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1115292263 14:31785524-31785546 ATTTTTCCATGGATGGGAGCAGG - Intronic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1115522874 14:34250971-34250993 ATTCTTCTACAAAGGGAGGCTGG - Intronic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1116122227 14:40735640-40735662 ATTTTAGTACAGGTGGAGGCTGG + Intergenic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1116959362 14:50954085-50954107 ATATTTCCTAGGATGGAGGCTGG + Intergenic
1117146324 14:52840050-52840072 CTTTTTCAACAAATGGTGGCGGG - Intergenic
1117559130 14:56917930-56917952 ATTTTTCCATATATGGGGGTGGG + Intergenic
1117706538 14:58475398-58475420 ATTTTTCCACAGACCAGGGCAGG - Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117767743 14:59100476-59100498 ATTTTTCCACAGACTGGGTCGGG + Intergenic
1117768032 14:59103135-59103157 ATTTTTCCACAGATGACAGTGGG - Intergenic
1118210850 14:63764514-63764536 TTTTTTTAAGAGATGGAGGCGGG - Intergenic
1118513827 14:66505869-66505891 ATTTTTCCATGGATGGAGATGGG - Intergenic
1118610320 14:67534252-67534274 ATTTTTCCAAAGGAGGAAGCTGG + Intronic
1118676048 14:68185655-68185677 ATTTTTCCGTGGATGGGGGCGGG + Intronic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119454434 14:74742514-74742536 GTTTTTCCACAGATGGCAGTGGG + Intergenic
1119612346 14:76074349-76074371 ACATTTCCACAGATGAAAGCTGG + Intronic
1120227122 14:81803348-81803370 ATTTGTAGACAGATGGAAGCTGG - Intergenic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120806277 14:88754387-88754409 ATTTGTCCAAAGGTGGAGGTGGG - Intronic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1121292610 14:92789108-92789130 ATGTTTCCACCGCTGGAGGAGGG + Intergenic
1121644348 14:95507572-95507594 GTTTTTACCCAGATGGAGGTGGG + Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1122144002 14:99677996-99678018 ATTTTTCCATGGATGGGGGTTGG + Exonic
1122170001 14:99864978-99865000 ATTTTTCCACAGAAGTGGGGCGG + Intronic
1122296784 14:100710291-100710313 AATTATCCACACATGGTGGCCGG - Intergenic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1122557228 14:102587707-102587729 ATTTTGCTGCAGATGGTGGCAGG - Intergenic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1124114964 15:26831894-26831916 ATTTTTCCACCGATTAGGGCAGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1124816619 15:33000435-33000457 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1124940876 15:34216865-34216887 ATTTTTCCACAAATGTGAGCTGG + Intergenic
1125006243 15:34821074-34821096 AGTTTTCCACAGTTGCATGCTGG + Intergenic
1125249025 15:37678140-37678162 ATTTTTCCATGGGGGGAGGCAGG + Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1125552456 15:40556234-40556256 GTTTTGCCATAGAGGGAGGCAGG - Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1126220087 15:46203605-46203627 GTTTTTAATCAGATGGAGGCTGG + Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127441885 15:59017152-59017174 ATTTTTCCACAGACCCAGGGTGG - Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1128934929 15:71738126-71738148 ATTTCTCCATGGATGGTGGCGGG + Intronic
1128956109 15:71947267-71947289 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1129141577 15:73602965-73602987 ATTTTTCCAAAGCAGAAGGCTGG - Intronic
1129218103 15:74113012-74113034 ATTTTTCTACAGACGGGGTCAGG + Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130195730 15:81778700-81778722 ATTTTTCCACAGACCAGGGCGGG + Intergenic
1130554184 15:84911225-84911247 ATCCTTCCAGAGAGGGAGGCAGG - Intronic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1131454613 15:92573385-92573407 CTATTTCCACAGAGAGAGGCCGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133650387 16:7807179-7807201 GTTTTTCCACCCATGGAGGCTGG - Intergenic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134459873 16:14421700-14421722 AATTTTCCACGGATGGGGGCGGG - Intergenic
1135191405 16:20357728-20357750 ATTTTTCCAGGGATGGGGGTGGG + Intergenic
1135605884 16:23824246-23824268 ATCTTTTCACAGATGTGGGCGGG + Intergenic
1135688942 16:24520944-24520966 ATTTTTCCAAATACAGAGGCTGG - Intergenic
1135693514 16:24565653-24565675 ATTTTTCCATGGACGGGGGCAGG - Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136060974 16:27726247-27726269 ATTTTCCCATGGATGGTGGCAGG - Intronic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1136724972 16:32349870-32349892 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1136843301 16:33555923-33555945 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1138625035 16:58244776-58244798 ATGTCTCCACAGAAAGAGGCTGG - Intronic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1138957511 16:61989335-61989357 GTTTTCCCACACATGGAGACTGG + Intronic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140358621 16:74326400-74326422 ATTTTTCCGCAGATTGGGACGGG + Intergenic
1140455027 16:75099995-75100017 ATTCTTCCACAGCAGGAGGCAGG - Intronic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141187602 16:81798948-81798970 CTTTTCCCACTGGTGGAGGCTGG - Intronic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1203001458 16_KI270728v1_random:167884-167906 AGTTTCCAAGAGATGGAGGCGGG + Intergenic
1203153466 16_KI270728v1_random:1856221-1856243 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1143516008 17:7419545-7419567 AATTTTCCATGGATGGAGGTAGG - Exonic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1144717688 17:17445794-17445816 ATTTTTCTGCAGAGGCAGGCGGG - Intergenic
1146738118 17:35257101-35257123 ATTTTTTCACGGATGGGGGTTGG - Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1148251012 17:46080349-46080371 TTTTTTCCCCAAATGGAGGTAGG - Intronic
1148623026 17:49048898-49048920 TTTCTTCCACGGATGGAGGTGGG - Intronic
1149040968 17:52187657-52187679 ATTTTTCCATAGATAGGGGCAGG + Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1150209053 17:63431741-63431763 ATTTTTCCACAGACCAGGGCTGG - Intergenic
1151088334 17:71406576-71406598 GTTTTTCTACAGATCGAGTCAGG + Intergenic
1151573724 17:74940720-74940742 ATTTTTCCATGGATGGAGGGTGG - Intronic
1151836711 17:76586648-76586670 ATTTTTCCACGGAGGGGGGTGGG + Intronic
1152155935 17:78632774-78632796 TTTTTTCCATGGATGGGGGCAGG - Intergenic
1152163688 17:78686700-78686722 ATTTTTCCACGGACAAAGGCAGG + Intronic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1155692936 18:28649470-28649492 ATTTTTCCATGGACTGAGGCGGG + Intergenic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1156053026 18:32961586-32961608 ATTTTTCCACAGACAGAGCAGGG + Intronic
1156287040 18:35706815-35706837 AGTTTTCAATGGATGGAGGCAGG - Intronic
1156774664 18:40772372-40772394 ATTTTTCCATGGATGGGGGATGG + Intergenic
1156886569 18:42141843-42141865 ATTTTTCTAAGGATGGTGGCAGG + Intergenic
1156949696 18:42880234-42880256 GTATTTCCAGAGATGGAGTCAGG - Intronic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157389142 18:47286952-47286974 AGTTTTCCCCTGCTGGAGGCAGG + Intergenic
1157635438 18:49148870-49148892 ATTTTTCCACGGATGCAGGGTGG + Intronic
1158530736 18:58257586-58257608 ATTTCTCCACAGCTGGAGACAGG - Intronic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159014868 18:63093090-63093112 ATTTTTCCACGGACAGGGGCCGG - Intergenic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1159682664 18:71373951-71373973 ATTTTACCACAGATAGTCGCTGG - Intergenic
1159937271 18:74379241-74379263 ATTTTTCCACAGACCAAGGTTGG + Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161535165 19:4814670-4814692 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1161786422 19:6328969-6328991 ATTTTTATACAGATGGGTGCTGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162513434 19:11133875-11133897 TTTTTTCCTGAGATGGAGCCTGG + Intronic
1162860731 19:13504657-13504679 ATTTTTACACAGAGGGCAGCTGG + Intronic
1164437103 19:28240124-28240146 ATATTGCCATAGGTGGAGGCTGG + Intergenic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1164890707 19:31820887-31820909 AAAATACCACAGATGGAGGCAGG + Intergenic
1165179260 19:33953804-33953826 ATTTCTCCCCAGAGAGAGGCAGG - Intergenic
1165235835 19:34420893-34420915 ATTTTTTCACAGACTGAGGTGGG + Intronic
1165996032 19:39844906-39844928 ATTCTACCACACATGGAGGAAGG + Intronic
1166089777 19:40501225-40501247 TTTTTTCAAGAGATGGAGTCTGG - Intronic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1168607556 19:57771834-57771856 TTTTTTCCCAAGATGGAGTCTGG + Intronic
925241634 2:2336003-2336025 ATTTTTCCACAGAACGTGTCGGG - Intergenic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926177122 2:10603984-10604006 ATTTTTCCACGGATGCAGGGAGG + Intronic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
928987955 2:37198832-37198854 ATTTTTATACAAATGGGGGCAGG - Intronic
929008302 2:37416526-37416548 ATTTTTCCACAAAGGGAGGGTGG - Intergenic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
930194539 2:48496235-48496257 ATTTGTCCACAGTTGGTGGCTGG + Intronic
931025408 2:58108616-58108638 AGACTTCCACAGATGGAGACAGG - Intronic
931278572 2:60766663-60766685 TTTTTTAAACAGATGGAGACGGG - Intronic
931838924 2:66128543-66128565 ATCTTCCCACAGGTGGAAGCTGG + Intergenic
931959424 2:67465730-67465752 ATTTTAGCACAGAGAGAGGCAGG + Intergenic
932169682 2:69542547-69542569 AGTTTTGCACTGATGCAGGCGGG + Exonic
932192665 2:69754020-69754042 CTCTTCCCACAGATGGATGCTGG - Intronic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933565074 2:83940301-83940323 GGTTTTCCAGAGATGTAGGCTGG - Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934321204 2:91973800-91973822 AGTTTCCAAGAGATGGAGGCGGG + Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935327612 2:101951399-101951421 ATTTTTCCACTGATGGACTTTGG - Intergenic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
937014192 2:118588669-118588691 ATTTTTCCACAGACCAGGGCAGG + Intergenic
937167202 2:119831042-119831064 ATTTTTCCATGGATGGGGGGTGG + Intronic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937650637 2:124315319-124315341 AGTTTTCCTCTGATGGAGGAAGG - Intronic
940312371 2:152292124-152292146 ATTTTTCCATGGATGGTGGTGGG - Intergenic
940534586 2:154924318-154924340 ATTTTACCACAGACTGGGGCGGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
942119479 2:172762586-172762608 ATTTGTCCCCAGTTAGAGGCAGG + Intronic
942376110 2:175339647-175339669 ATTTTTCCCCTGCTGGAGCCAGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942628169 2:177925995-177926017 ATTTTTCTTCAAATGGAGGAAGG - Intronic
942647192 2:178125461-178125483 ATTTCTCCACAGGTGAAAGCTGG + Intronic
942810013 2:179987927-179987949 ATTTTTCCACAGATGTTAGGGGG + Intronic
943104570 2:183528671-183528693 ATCTTTCCTCACATGGTGGCAGG - Intergenic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943162298 2:184269847-184269869 ATTTTTCCATGGATGGGGGTGGG + Intergenic
943389053 2:187239611-187239633 ATTTTTCCACAAATGAATCCTGG + Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944777431 2:202981150-202981172 ATTTTTCCACAGACCCAGGGTGG + Intronic
945690793 2:213032770-213032792 ATCTTTCCACTGGTGGAGGAGGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946502751 2:220267200-220267222 ATTTTTCCATGGATGGTGGGTGG + Intergenic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947211223 2:227710382-227710404 ATTTTTGTAGAGATGGAGTCTGG - Intronic
947299154 2:228668721-228668743 ATATTGCCACAGAAGGTGGCAGG + Intergenic
948535789 2:238645686-238645708 ATTTTTCCACAGACCGGGGAAGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948615072 2:239193256-239193278 AATTTCTCACAGATGGAGGGAGG + Intronic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1170127967 20:12986967-12986989 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1171528357 20:25834019-25834041 AGTTTTGCAAAGATGGAGCCTGG + Intronic
1171548469 20:26021859-26021881 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1175866250 20:62178721-62178743 ATTTTTGTAGAGATGGAGTCTGG + Intronic
1176295533 21:5070139-5070161 ATTTTTCCATGGATGCAGGTAGG + Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1178202423 21:30422637-30422659 GTTTTTCCACAGATTGGAGCAGG + Intronic
1178306161 21:31491809-31491831 ATTTTTTCAAGGATGGAGGTTGG + Intronic
1178319776 21:31596583-31596605 ATTTTTCCATACATGGGGGTGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1179861517 21:44191985-44192007 ATTTTTCCATGGATGCAGGTAGG - Intergenic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180284507 22:10731367-10731389 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1180309451 22:11157772-11157794 AGTTTCCAAAAGATGGAGGCGGG + Intergenic
1180547928 22:16519583-16519605 AGTTTCCAAAAGATGGAGGCGGG + Intergenic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182211532 22:28680788-28680810 AGTTTTCAAGAGATGGAGGCGGG - Intergenic
1183493740 22:38130063-38130085 ACATTTCCACACCTGGAGGCCGG + Intronic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185189455 22:49425206-49425228 ATTTTCCCACGGATGGAAGTGGG + Intronic
949186940 3:1203246-1203268 CTTTTCTCACAGATGGGGGCAGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949434410 3:4013048-4013070 ATTTTTCCCCATATGGAGGTGGG + Intronic
950952825 3:17018537-17018559 TTTTTTCAACAGATGGGGCCTGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952186164 3:30971394-30971416 ATTTTCTCACAGATTGAGGTAGG + Intergenic
952202123 3:31141411-31141433 ATTTTAACAGAGAAGGAGGCAGG - Intergenic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
954055243 3:48017893-48017915 ATTTTTCCACAGATAGCAGGAGG + Intronic
955904162 3:63789286-63789308 ATTTTTCCATGAATGGAGGAAGG - Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957833519 3:85554094-85554116 ATTTTTCCACAGAAGTAGTCAGG + Intronic
957856172 3:85881795-85881817 ATTTTTCCATGGATGGTGGGCGG + Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
959077688 3:101766948-101766970 TTTTTTAAAGAGATGGAGGCTGG + Exonic
959106531 3:102071160-102071182 ATTTTTCCATGGATGGGGGAGGG + Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960333317 3:116389259-116389281 ATTCTACCACAGCTGGAGGTAGG - Intronic
960672910 3:120169344-120169366 GTTTTTCCACAGATAGTGGTGGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961488775 3:127236253-127236275 AATTTTCCACAGATGAGGGGAGG - Intergenic
961580809 3:127880478-127880500 ATTTTTCCACTGATGAGGGTGGG + Intergenic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
962950735 3:140216215-140216237 ATTTTTCCATGGATGGGGGTGGG - Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
965796376 3:172443941-172443963 ATTTTTCAAGTGATGAAGGCAGG - Intergenic
965946069 3:174242802-174242824 ATTTTTCCATGGATGGGGGCGGG - Intronic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
966763379 3:183436711-183436733 ATTCTTACACTAATGGAGGCTGG - Intergenic
967455160 3:189676862-189676884 ATTTTTCCACTGATGTTGGGGGG - Intronic
968458553 4:711766-711788 ATTTTTCTACAGAATTAGGCAGG + Intronic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
971917368 4:32890343-32890365 ATTTTTCCATAGACAGGGGCAGG + Intergenic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973095968 4:46200177-46200199 GTTTTTCCACAGATGTTGGGTGG - Intergenic
973312666 4:48726384-48726406 AAATTTCCACAGATGCGGGCGGG + Intronic
973654233 4:53029212-53029234 ATTTTTCCAAAGATGAAGATTGG - Intronic
974991998 4:69104333-69104355 ATTTTTATAAAGATGGAGTCTGG + Intronic
975070688 4:70133850-70133872 ATTTTTCCACGGATGAGGGCGGG - Intronic
975404592 4:73975539-73975561 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
975798754 4:78036440-78036462 ATTTTTCCATGGATGGAGGTGGG + Intergenic
976198272 4:82554860-82554882 TTTATTCCACAGATAGAGTCTGG + Intronic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
977957946 4:103052141-103052163 ATTTTTCCACTGATGGCAGGGGG + Intronic
978036174 4:103998019-103998041 TTTTCTCCACAGGTGGATGCAGG + Intergenic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
979704331 4:123703529-123703551 ATTTCTCCAGTTATGGAGGCTGG - Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
981269070 4:142822622-142822644 GTTTTTACACGGATGGAGTCGGG - Intronic
981671060 4:147287476-147287498 ATTTGTCCAGATATGGAGGAGGG + Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983097827 4:163585824-163585846 CTTTATCCACTGGTGGAGGCAGG + Exonic
983139078 4:164125916-164125938 GTTTTTCCACAGAATGGGGCAGG - Intronic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984364929 4:178786273-178786295 ATTTTTCCATGGATGGGGGGTGG + Intergenic
984376856 4:178942364-178942386 ATTTTTCTATGGATGGAGGAAGG - Intergenic
984385269 4:179047845-179047867 ATTTTTCCAGGGATGGTGGGTGG + Intergenic
984404301 4:179307442-179307464 GTCTTCCCACAGATTGAGGCAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
985164038 4:187074016-187074038 GTTTTTGCACAGAGAGAGGCTGG + Intergenic
985284252 4:188318895-188318917 AATTTCCAACACATGGAGGCTGG - Intergenic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986404323 5:7410737-7410759 TTTTTTCCACAAAGGGAGGAGGG + Intronic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
987230702 5:15890677-15890699 ATTTTTTCACACATGCAGGGAGG - Intronic
987310115 5:16673914-16673936 ATTTTTAGACTGATGGGGGCTGG + Intronic
987910605 5:24139181-24139203 ATTTTTCCAAGGATGAGGGCGGG + Intronic
988159922 5:27505474-27505496 TTTTTTCCACAAATGCAAGCTGG - Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988392911 5:30658872-30658894 ATTTTTCCATGGATGGTGGAAGG + Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988813599 5:34808792-34808814 ATTTTTCCATGGATGGGGGTGGG + Intronic
989092030 5:37743569-37743591 ATTTTTCCCCTGCTGGAGCCAGG + Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991949383 5:71933032-71933054 ACTTTTCCAGAGAGTGAGGCTGG + Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992485650 5:77191722-77191744 ATATTTCCACAGATCGAAGGTGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993253414 5:85556682-85556704 ATTTTTCCCCTGTTGGAGCCAGG + Intergenic
993341041 5:86725318-86725340 ATTTTTCCATTGATGGACACAGG + Intergenic
993764550 5:91839813-91839835 ATTTTTCCACATATTAAGTCAGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994395023 5:99220237-99220259 ATTGTTCCAAATATTGAGGCAGG - Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
994981703 5:106883006-106883028 AGTTTGCTAGAGATGGAGGCTGG - Intergenic
995548758 5:113258615-113258637 ATTTTTCCACAGACAGTGGCAGG - Intronic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996228326 5:121029982-121030004 ATTTTTCCACAGACTGTGGTGGG + Intergenic
996331179 5:122330734-122330756 ATTTTTCCATAGTTGGGGGAGGG + Intronic
997098165 5:130937408-130937430 ATTTTTCCGCAGATGAAGGGGGG - Intergenic
997715619 5:136040550-136040572 ATATTTCCCCAGATGGTGGCAGG - Intronic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998135896 5:139674344-139674366 ATTTTGCCTCACTTGGAGGCAGG + Intronic
998240787 5:140442405-140442427 ATTTTTCCACACGTGGGGGAGGG + Intronic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
998883811 5:146673235-146673257 ATCTTACCACAGATGCTGGCGGG + Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999639538 5:153658331-153658353 ACTTGGCAACAGATGGAGGCTGG - Intronic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999725711 5:154435651-154435673 ATTTTTCCACGGTTGGGGGTGGG - Intergenic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001853799 5:174993164-174993186 AGCTTTCCTCAGATGGAGGTTGG + Intergenic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002765049 6:232224-232246 ATTTTTCCACGGACTGGGGCAGG + Intergenic
1003167733 6:3695975-3695997 ATTGTTCCCCAGCTGGAGGAAGG - Intergenic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1005141384 6:22635729-22635751 ATTTTTACAGAGAAGCAGGCAGG - Intergenic
1005283288 6:24298053-24298075 ATTTCTCCACAGACGGAGTGGGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1006237311 6:32645310-32645332 ATTTTTCCACAGATAGTTGGGGG + Intronic
1006273932 6:32986053-32986075 ACTTTTCTATGGATGGAGGCGGG + Intergenic
1006512822 6:34530783-34530805 ATTTTTCCACGGATGGGAGCGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008523902 6:52388443-52388465 ATTTTTCCACGTATGGGGGCTGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008836713 6:55841159-55841181 ATTTTTCCATGGATGCAGGGTGG - Intronic
1008967487 6:57327851-57327873 ATTTTTCCACGGACTGAGGTCGG + Intronic
1010042973 6:71408785-71408807 ATTTTTCAAAAGAAGGATGCTGG - Intergenic
1010287950 6:74101172-74101194 ATTTTTCCACATTAGGAGGGAGG + Intergenic
1010704543 6:79091947-79091969 ATTTTTCTTCACATGGTGGCAGG + Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011569914 6:88724546-88724568 ATTTTTCCACAGACAGGGGAAGG + Intronic
1011571870 6:88746495-88746517 ATTTTTCCACAAATGTTGGTGGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1011814528 6:91172990-91173012 TTTTTTCCACAGAGGGTGGCTGG + Intergenic
1012453176 6:99375317-99375339 ATTTTTCCACTGGTGCAGTCGGG - Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013547586 6:111173897-111173919 ATTTTTCCATGGATGGTGCCGGG - Intronic
1013770789 6:113625604-113625626 AGTTCTCTAGAGATGGAGGCAGG - Intergenic
1013996982 6:116320605-116320627 ATTTTCTCACATCTGGAGGCTGG + Intronic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014212715 6:118723141-118723163 ATCTTTCCACAGAGGTAGTCTGG - Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014744995 6:125190486-125190508 GTTTTTCCACAGACGAAGGTTGG + Intronic
1014747504 6:125217209-125217231 ATTTTTCCACAGACAAAGGGTGG + Intronic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015201194 6:130583294-130583316 ATTTTTCCACAGGATGGGGCAGG + Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1016663007 6:146602884-146602906 ATTTTTCCATGGATGGAGAGGGG - Intronic
1017055820 6:150434733-150434755 ATATTTCCATGGATGGAGGTGGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017324050 6:153126996-153127018 ATTTTTCCACGGATGGCAGTGGG + Intronic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1017849680 6:158294442-158294464 TTCTGTCCACAGATGGAAGCAGG - Intronic
1018045860 6:159965770-159965792 ATTTTTCCATGGATGGTGGAGGG - Intergenic
1018222073 6:161591155-161591177 ATATGTACACAGATGGAGACAGG + Intronic
1020727264 7:11831758-11831780 AGTCTTCCACAGATAGAGGGTGG + Exonic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021311084 7:19097669-19097691 ATTTTTGCACATATGTGGGCTGG + Intronic
1021497222 7:21289166-21289188 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1022358112 7:29634968-29634990 CTCTTTCCCCAGATAGAGGCTGG + Intergenic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1023835443 7:44064894-44064916 ATTGTTCCCCAGATCAAGGCCGG - Exonic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025167771 7:56727952-56727974 TTTTTTACAGAGATGGAGTCTGG - Intergenic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1027379452 7:77590858-77590880 TTTTTTTAATAGATGGAGGCCGG - Intronic
1027706906 7:81546859-81546881 ATTTTTCTTCAGATCTAGGCAGG + Intergenic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1030016746 7:105230240-105230262 ACTTTGACAGAGATGGAGGCTGG + Intronic
1030350115 7:108475326-108475348 GTTTTTCCGCACATGGGGGCGGG - Intronic
1030479263 7:110081879-110081901 ATTTTTCCATGGATGGGGGCAGG + Intergenic
1030656863 7:112178042-112178064 ATTCTTCCACATCTGGATGCTGG - Intronic
1031223949 7:119010566-119010588 ATTTTTCCACAAATGAAGGTGGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031322239 7:120345738-120345760 ATTTATCCATAGATGGACACAGG + Intronic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032822277 7:135535150-135535172 ATCTTTCCACTGAGGAAGGCTGG + Intergenic
1033135425 7:138780212-138780234 GTTTTTCCACGAATGGAGGTTGG + Intronic
1033848295 7:145462692-145462714 ATTGTTCCACATAAGGAGGCTGG + Intergenic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034360019 7:150486997-150487019 TTTTTTTCAGAGATGGAGGCAGG + Intergenic
1036132707 8:6131276-6131298 ATTTTTCCACGGATGAGGACGGG + Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038696805 8:29813462-29813484 ATTTTTCCATGGATGGGAGCAGG - Intergenic
1039355291 8:36808834-36808856 ATTTTTCAAAAAATGGATGCTGG - Intronic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1040907451 8:52483280-52483302 ATTTTTCCACAGACCAAGGGTGG + Intergenic
1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG + Intergenic
1041042052 8:53857063-53857085 ACTCTTTCACAAATGGAGGCAGG - Intronic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041351226 8:56949910-56949932 ATTTTTCCACAGACTAAGGCAGG - Intergenic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041702898 8:60811084-60811106 ATTTTTCCACGGACTGGGGCGGG - Intronic
1041819099 8:62009418-62009440 ATTTTTCCAGGGATTGAGGTGGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042110193 8:65373383-65373405 ATTTTTCCACATTTGTGGGCTGG - Intergenic
1042378250 8:68081127-68081149 ATTTTTCCACAGGCGGAGGGTGG + Intronic
1043005579 8:74814352-74814374 ATTTTTCCACAGACGAGGGAGGG + Intronic
1043866829 8:85384163-85384185 ATTTTTCCACAGACCGACGTGGG - Intronic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044075429 8:87816170-87816192 ATTTCTCCACTGATAGAGGCTGG + Intergenic
1044997946 8:97855014-97855036 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045531509 8:102989437-102989459 ATTCTTCCACACATGGTGGTAGG - Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1047276305 8:123408281-123408303 GGATTTCCACAGAAGGAGGCTGG - Intronic
1047688906 8:127330662-127330684 GATTTACAACAGATGGAGGCAGG + Intergenic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1050440567 9:5658729-5658751 GTTTTTTCAGAGATGGAAGCAGG + Intronic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1051434550 9:17016961-17016983 ATTTTTCGAAAGAGGGAGGGAGG - Intergenic
1051689606 9:19696237-19696259 GTTTTTCCACAGACCGAGGTTGG - Intronic
1051870815 9:21735686-21735708 ATGTTTCCACAAAGGGGGGCTGG + Intergenic
1051954407 9:22673334-22673356 ATTTTTCCACAGGAGGCTGCAGG - Intergenic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052597749 9:30582300-30582322 ATTTTTCCACACACAGAGGGTGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1053270528 9:36746357-36746379 ATCTTTCCCCAGGTGGGGGCTGG - Intergenic
1053534015 9:38907969-38907991 ACTACTCCAGAGATGGAGGCAGG + Intergenic
1054148858 9:61584710-61584732 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054184729 9:61942222-61942244 AGTTTTGCAAAGATGGAGCCTGG + Intergenic
1054206239 9:62132388-62132410 ACTACTCCAGAGATGGAGGCAGG + Intergenic
1054468621 9:65515819-65515841 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054632118 9:67455958-67455980 ACTACTCCAGAGATGGAGGCAGG - Intergenic
1054653778 9:67646275-67646297 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055409979 9:76018577-76018599 ATTTTTCCACGGATGTGGGGTGG - Intronic
1055602148 9:77931064-77931086 ATTTTTCCAGGGATGGGGGTCGG - Intronic
1055767882 9:79684599-79684621 ATTTTTCCATGGACGGAGGTGGG - Intronic
1056232025 9:84556873-84556895 ACTTTTACTCAGATGGTGGCTGG + Intergenic
1056325219 9:85472288-85472310 ATTTTTCCACAGACCAGGGCAGG - Intergenic
1056593754 9:87987752-87987774 AGTTTTCCACGGATGGAAGTAGG - Intergenic
1057028218 9:91752858-91752880 ATTGATGGACAGATGGAGGCTGG + Intronic
1057586332 9:96331954-96331976 ATTTTTCCATGGATGCAGGATGG - Intronic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1059313278 9:113403008-113403030 ATGTTTCAAAAGGTGGAGGCTGG - Intergenic
1059325125 9:113499619-113499641 ATATTTCCACCTATGTAGGCTGG + Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1059976228 9:119720238-119720260 ACTTTTCCAGAGATGAAGGCAGG - Intergenic
1060333950 9:122704153-122704175 TTTTTTCCACGGATGGTGGGAGG - Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1060874382 9:127070067-127070089 GTTTTTCCACGGATGGAGAGTGG + Intronic
1061319733 9:129820980-129821002 ATTTTTCCATAGATACAGTCAGG + Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061484462 9:130913308-130913330 ACTCTGACACAGATGGAGGCCGG - Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1185985338 X:4826530-4826552 ATTTTTCCATGGATGAAGGTTGG + Intergenic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186682030 X:11885126-11885148 ATTTATCCACTGATGGACACTGG - Intergenic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187050267 X:15688790-15688812 ATTATTCCAGACGTGGAGGCAGG - Intergenic
1187058680 X:15764707-15764729 ATTATTCCAGACGTGGAGGCAGG - Exonic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1192752894 X:74012808-74012830 AATTTTCCACACATGATGGCAGG - Intergenic
1192850410 X:74949970-74949992 ATTTTTCCATGGACGGTGGCGGG - Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193599604 X:83493983-83494005 ATTTTTCCACAGACAGGTGCTGG - Intergenic
1193763899 X:85502198-85502220 ATTTTTATACAGATTGATGCAGG + Intergenic
1194786223 X:98087311-98087333 ATTTTTCCACAAATGGTTGGGGG + Intergenic
1194891521 X:99384919-99384941 ACTTTGGCACAGAGGGAGGCTGG - Intergenic
1195042323 X:101025808-101025830 ATTTTGCCAGACATGGTGGCGGG + Intronic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195758191 X:108220004-108220026 AGTTTTCCCCAGATGGCAGCAGG - Intronic
1195768866 X:108327326-108327348 ATTTTTCCATAGAAGGGGCCGGG - Intronic
1196628609 X:117908539-117908561 ATTTTTCCAAAAATAAAGGCAGG - Intronic
1196866486 X:120075935-120075957 TTTCTTCCATAGAAGGAGGCTGG - Exonic
1196876613 X:120160346-120160368 TTTCTTCCATAGAAGGAGGCTGG + Exonic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1197840874 X:130745037-130745059 ATTTTTCCACAGACTGAGTCGGG - Intronic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1198445285 X:136707487-136707509 ATTTTTCTACAAATGAAGACAGG - Intronic
1200825297 Y:7632245-7632267 ATTTTTCCACAGATCATGGGTGG + Intergenic
1200834391 Y:7718639-7718661 TGTTTTCCATAGATGGAGGGTGG - Intergenic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic
1202070326 Y:20985468-20985490 ACTTTTCCCCTGATGGAGACAGG - Intergenic
1202202602 Y:22369112-22369134 ATTTTTCCACAGATAATGGGTGG - Intronic
1202234759 Y:22698841-22698863 ATTTTTCCACAGATCATGGGTGG - Intergenic
1202308400 Y:23497327-23497349 ATTTTTCCACAGATCATGGGTGG + Intergenic
1202562401 Y:26173259-26173281 ATTTTTCCACAGATCATGGGTGG - Intergenic