ID: 1061846131

View in Genome Browser
Species Human (GRCh38)
Location 9:133389436-133389458
Sequence CAGAGCAGCCAGCAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 513}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061846131_1061846141 23 Left 1061846131 9:133389436-133389458 CCACCATCCTGCTGGCTGCTCTG 0: 1
1: 0
2: 4
3: 66
4: 513
Right 1061846141 9:133389482-133389504 ACAGGGTGCCCCTCCCATCCTGG 0: 1
1: 0
2: 1
3: 23
4: 400
1061846131_1061846135 6 Left 1061846131 9:133389436-133389458 CCACCATCCTGCTGGCTGCTCTG 0: 1
1: 0
2: 4
3: 66
4: 513
Right 1061846135 9:133389465-133389487 ACCCCCCTGAAAGCAGCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 142
1061846131_1061846134 5 Left 1061846131 9:133389436-133389458 CCACCATCCTGCTGGCTGCTCTG 0: 1
1: 0
2: 4
3: 66
4: 513
Right 1061846134 9:133389464-133389486 CACCCCCCTGAAAGCAGCACAGG 0: 1
1: 0
2: 1
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061846131 Original CRISPR CAGAGCAGCCAGCAGGATGG TGG (reversed) Intronic
900000488 1:12346-12368 CAGACCAGCCGGCTGGAGGGAGG + Intergenic
900020201 1:182865-182887 CAGACCAGCCGGCTGGAGGGAGG + Intergenic
900561358 1:3308660-3308682 CAGAGCTGCCCTCAGGCTGGAGG - Intronic
901632147 1:10653204-10653226 CATAGAAACCAACAGGATGGGGG + Intronic
901635497 1:10668398-10668420 TAGAGCAGCGGGCAGGCTGGTGG - Intronic
903938929 1:26915335-26915357 CAAAGCAGGCAGCAGCAAGGTGG - Intronic
904040519 1:27581830-27581852 GAGAACAGCCAGGAGGTTGGTGG - Intronic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
905015669 1:34776975-34776997 CAGATCAGGCAGAGGGATGGGGG - Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905441819 1:38000768-38000790 GAGAGCAGCCTTCATGATGGAGG - Intronic
905516266 1:38564292-38564314 CAGAGGAGGAAGCAGGCTGGGGG - Intergenic
905902756 1:41592634-41592656 CAGAGAAGCCAAGAGGATGGTGG - Intronic
906758669 1:48348853-48348875 CAAAGAAGCCAGGAGGATGAAGG - Intronic
907526736 1:55058165-55058187 CAGGGCGGCCACCAGGTTGGGGG - Exonic
907538870 1:55193583-55193605 TTTAGCAGCCAGCAGGAAGGAGG + Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
908090200 1:60677725-60677747 AAGAGCAGCCAGCAGCTTGCAGG - Intergenic
908301228 1:62762278-62762300 CAGATCAATCAGCAGGATGTGGG + Intergenic
908837841 1:68245826-68245848 CAGAGCAGTCAGTAGAATGCTGG - Intergenic
910101481 1:83582845-83582867 CAGGGCAGCCTGAAGCATGGGGG - Intergenic
910105521 1:83627637-83627659 CAGAGCTGCAGGCAGGAAGGTGG + Intergenic
910267342 1:85351768-85351790 AAGGGCAGAAAGCAGGATGGTGG + Intronic
910589934 1:88919449-88919471 CTGAGCAGCCTGCAGCAGGGAGG + Intergenic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912388742 1:109286739-109286761 CAGAGCAGCCCGAGGGCTGGTGG + Intergenic
912390350 1:109298310-109298332 CACAGCAGGCAGCTGGATGCAGG - Intronic
912684557 1:111752091-111752113 CATTGCAGCCAGCAGGAAGGAGG - Intronic
912694202 1:111828690-111828712 CAGAGCTGGTGGCAGGATGGGGG - Intronic
912748463 1:112265811-112265833 CATTCCAGGCAGCAGGATGGAGG - Intergenic
913195176 1:116450362-116450384 CAAAGCACCCAGCAACATGGTGG + Intergenic
913256229 1:116956549-116956571 CAGAGCAGCAGGAAGGAAGGCGG + Intronic
913287607 1:117241162-117241184 CAGAGGAGCCAGCAGGAGCTGGG - Intergenic
914196439 1:145450425-145450447 CTGAGCAGAGGGCAGGATGGTGG + Intergenic
915550168 1:156627806-156627828 CAGCTCAGCCAGCAGGAGGATGG + Intergenic
916804265 1:168243465-168243487 CTGTGCAGCCAGCAGGAAGTAGG + Exonic
917406455 1:174712174-174712196 CAGACCAATCAGCAGGATGTGGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
919995022 1:202740384-202740406 CAGGGCAGCCGGCCGGGTGGGGG + Intronic
920286708 1:204884817-204884839 CATAGCACCCAGCATGCTGGTGG - Intronic
920808405 1:209257049-209257071 CAGAGCAGACAGCAGACGGGAGG + Intergenic
922781874 1:228259295-228259317 CAGGGCACCCTGCAGAATGGTGG - Intronic
922790154 1:228306778-228306800 CAGAGCAGCTACGAGGAAGGAGG - Intronic
922879585 1:228970576-228970598 AGGAGCAGCCAGCTGGTTGGTGG - Intergenic
923108083 1:230869125-230869147 CAGGGCAGCCCGGAGGCTGGAGG + Intronic
924665791 1:246070220-246070242 CAGTTCAGCCCTCAGGATGGAGG - Intronic
1063045208 10:2384740-2384762 CAGAGCAGCCAGCAGCCAGTCGG - Intergenic
1063103606 10:2973393-2973415 CAGAGCAGCCATCAGGGTTCTGG + Intergenic
1063930845 10:11027169-11027191 CAGAGCTGCCAGCAGCATTCAGG - Intronic
1065487209 10:26247114-26247136 CAGAGCAGCCTGGAGGCTGCTGG + Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067077091 10:43194107-43194129 CAGGGCAGCCTGCAGAATGCAGG - Intergenic
1067248036 10:44562530-44562552 CAGAGTAGCTAGCAGGCTGCTGG + Intergenic
1067557362 10:47282322-47282344 GAGGGCAGTCAGCAGGAAGGGGG - Intergenic
1067846252 10:49723981-49724003 CTGAGAAGCCAGCAGAAAGGGGG - Intergenic
1068784859 10:60960884-60960906 CAGAGCTGACAGCAGGATTGTGG + Intronic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070595942 10:77833311-77833333 CAGAACAGACTGCTGGATGGGGG + Intronic
1070668815 10:78363780-78363802 CAGAGATCCGAGCAGGATGGAGG + Intergenic
1070783624 10:79150913-79150935 GAGAGCACCCACCAGGAGGGAGG - Intronic
1071302359 10:84265516-84265538 GAGAGCTGCCAGGTGGATGGAGG - Intergenic
1072166172 10:92815078-92815100 CAGTCCAGGCAGCAGGAAGGAGG - Intergenic
1073429864 10:103479086-103479108 CACAGCAGACACCAGGAAGGTGG - Exonic
1073733215 10:106315759-106315781 CAGAGGAGCCAGGATGATGCAGG + Intergenic
1073792552 10:106955106-106955128 CAGTGCAGCAAACAGGGTGGGGG - Intronic
1074588732 10:114792577-114792599 AGGAGCAGCCAGCAGGAGGTAGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076280744 10:129244009-129244031 CCAAGCTGCCAGCAGGCTGGTGG - Intergenic
1077007410 11:364751-364773 CCGAGCAGCAAGCAGGATGGAGG + Intergenic
1077098509 11:810248-810270 TAGGGCAGCCAGCAGGTAGGAGG - Exonic
1077217607 11:1401543-1401565 CAGTGCAGCCTGCAGGAGGTGGG - Intronic
1077219334 11:1408451-1408473 CACAGCGGCCACCAGGCTGGGGG + Intronic
1077298804 11:1838001-1838023 CAGAGGAGACAGCAGCGTGGAGG - Intergenic
1077529434 11:3088251-3088273 CAGAGCAGGAACCAGGATCGGGG + Exonic
1078061003 11:8043982-8044004 AAGAGCAGCCAGAAGAAGGGGGG - Intronic
1078432403 11:11298133-11298155 CAGGGTATCCTGCAGGATGGGGG - Intronic
1078589996 11:12632169-12632191 GGGAGCAGCCAGGAAGATGGAGG - Intergenic
1080676418 11:34432014-34432036 CAGAGCAGCAAGGATGAAGGAGG - Intergenic
1081603008 11:44508303-44508325 CAGAGCAGCCACCAGTCTGAAGG + Intergenic
1082679194 11:56147802-56147824 CAAATCAGACAGTAGGATGGAGG + Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1083320493 11:61842961-61842983 CAGTGCAGCCAACAGGAAGAAGG - Intronic
1083724869 11:64622843-64622865 CATGTCAGCCAGCAGGGTGGTGG + Exonic
1083749280 11:64752593-64752615 CAGAGCAGCCTGCTGGGTGAAGG - Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083764008 11:64833568-64833590 CAGAGGGGCAAGCAGGGTGGGGG - Intronic
1084297830 11:68224697-68224719 AACAGTAGCCACCAGGATGGTGG - Intergenic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084758947 11:71256205-71256227 CAGGGCATCCTGTAGGATGGAGG + Intergenic
1085435090 11:76493115-76493137 CGGAGCAGACAGCAGGAGCGGGG - Intronic
1085689920 11:78656504-78656526 GGCAGCAGCCAGCAGGCTGGGGG - Exonic
1085801382 11:79593251-79593273 CAGAGCACACAGCAGCATTGTGG + Intergenic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087943192 11:104126232-104126254 CAGAGCAGCCTGTAAGCTGGAGG + Intronic
1088256504 11:107908433-107908455 GAGGGCAGCCAGCAGGTAGGAGG - Intronic
1088716812 11:112555865-112555887 CTGAGCAGCCAGAAGGGTGAGGG - Intergenic
1088985202 11:114899650-114899672 TAGAGCAGCAAGCAGGCTTGTGG + Intergenic
1089006056 11:115091616-115091638 CATAGCAGGCATCAGCATGGAGG - Intergenic
1089353318 11:117833717-117833739 CAGAGCAGCCAGGAACAAGGTGG + Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089401344 11:118166392-118166414 CAGAGCAGCCATCAGGCTGGAGG - Exonic
1089557713 11:119323770-119323792 CAGAGCAGGTGGGAGGATGGGGG + Intergenic
1089666492 11:120023550-120023572 CACAGCAGCCAGAAGTATGGAGG - Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1092526245 12:9311951-9311973 CAGACCAGCCAGCTGGAGGGAGG + Intergenic
1092541031 12:9419839-9419861 CAGACCAGCCAGCTGGAGGGAGG - Intergenic
1094000292 12:25687297-25687319 TGGACCAGTCAGCAGGATGGGGG + Intergenic
1094512014 12:31102647-31102669 CAGACCAGCCAGCTGGAGGGAGG + Intronic
1095397248 12:41775091-41775113 GAAAGCAGCCAGGAGGATGAAGG - Intergenic
1095583582 12:43827197-43827219 CAGAGCATCAAGAAGGATGTGGG - Intergenic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096264270 12:50111093-50111115 CAGATCAGGCAGCAGGAGTGAGG + Exonic
1096522252 12:52191119-52191141 CAGAAAAGCCAGCAGGGTGGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098519700 12:71421261-71421283 CAGAGCAGGCACCAGGAGTGGGG + Intronic
1099616146 12:84938361-84938383 CAGAGCAACAAGCAGGGTGTTGG + Intergenic
1100604930 12:96143801-96143823 CAAAGGAGCCTGCTGGATGGTGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101585748 12:106084063-106084085 GAGAGCAGCCTGAAGGATGGAGG - Intronic
1101807294 12:108075516-108075538 CATTCCAGCCAGCAGGAAGGAGG - Intergenic
1101835092 12:108289429-108289451 CAGAGCAGCCAGAAAGAGGGAGG + Exonic
1102145986 12:110655482-110655504 CAGAGGCCCCACCAGGATGGAGG + Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102446391 12:113006153-113006175 CAGAGCAGCCACCAGCAATGTGG - Intronic
1102478254 12:113202665-113202687 CAGTCTAGCCAGCAGGAAGGAGG - Intronic
1102576642 12:113860096-113860118 CAGAGGAGGCACCAGGAGGGGGG - Intronic
1102957764 12:117070411-117070433 CAGCCCAGCCTGCAGGAAGGAGG - Intronic
1102988469 12:117297677-117297699 CACTGCACCCAGCTGGATGGTGG + Intronic
1103013647 12:117477181-117477203 CAGAGAAGCCTTGAGGATGGAGG - Intronic
1103703276 12:122858841-122858863 CAGAGCTGCCACCAGGGCGGAGG - Exonic
1104742445 12:131188477-131188499 CAGAGCAGCCACCAGGAACAGGG - Intergenic
1105472631 13:20706061-20706083 CAGAGTAGCCAGGAGGCAGGAGG - Intronic
1107124465 13:36831500-36831522 CATTCCAGGCAGCAGGATGGAGG - Intergenic
1107186584 13:37529400-37529422 CATAACAGCCAGGAGGAGGGAGG - Intergenic
1107400796 13:40067023-40067045 CTGAGCAGCCAGCATGAGGCAGG - Intergenic
1107408700 13:40138910-40138932 CAGGGCAGCCAGCAGGGTGAGGG + Intergenic
1107420898 13:40245354-40245376 CTGAGCAGCCAGCAGAATTATGG + Intergenic
1108243661 13:48493398-48493420 CACAGCAGCCAGGAGGCAGGAGG + Intronic
1108244308 13:48499383-48499405 CATTGCAGGCAGCAGCATGGAGG - Intronic
1111202918 13:84962402-84962424 CACAGCAGGCACCAGGATTGAGG + Intergenic
1112783511 13:102927478-102927500 CAGAGCCCCAAGCAGGATGCTGG - Intergenic
1113048699 13:106184901-106184923 CACTGCAACCAGGAGGATGGGGG - Intergenic
1113260057 13:108552003-108552025 CAGAGCAGGCTTCAGGCTGGCGG + Intergenic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1117763934 14:59060607-59060629 CAGAGCAGAGTGCAGAATGGTGG + Intergenic
1118601066 14:67471788-67471810 CAGGGCAGCCAGCAGGGAAGAGG + Exonic
1119320561 14:73727577-73727599 CAGGGCAGCCACTAGGATTGGGG - Intronic
1119406568 14:74402857-74402879 CGGGGCAGCCAGCAGAGTGGGGG - Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120439654 14:84520382-84520404 CAGAGCACCCAGCAGGCTCTTGG - Intergenic
1120943091 14:89968001-89968023 CATAACAGCAAGTAGGATGGAGG + Intronic
1121007718 14:90500935-90500957 CAGAGGAGACAGCAGGACTGGGG + Intergenic
1121979729 14:98444130-98444152 TAGAGCAGCATGCAGGTTGGAGG - Intergenic
1122289457 14:100672390-100672412 CAGAGCAGACAGCAGCAGAGGGG + Intergenic
1122327527 14:100891445-100891467 CAAACCACCCAGCAGGGTGGGGG + Intergenic
1122348261 14:101073576-101073598 CACAGCCCTCAGCAGGATGGTGG - Intergenic
1122451274 14:101809957-101809979 TAAAGCGGGCAGCAGGATGGTGG + Intronic
1123065506 14:105617027-105617049 CAGAGCAGCAAGCAGGACTCTGG - Intergenic
1123069704 14:105636491-105636513 CAGAGCAGCAAGCAGGACTCTGG - Intergenic
1123088786 14:105732210-105732232 CAGAGCAGCAAGCAGGACTCTGG - Intergenic
1123094724 14:105761533-105761555 CAGAGCAGCAAGCAGGACTCTGG - Intergenic
1123108992 14:105856534-105856556 CAGGGCAGCCAGCTGAATGGTGG - Intergenic
1123938981 15:25207642-25207664 CAGGGCAGCCAGCAGGGCAGTGG + Intergenic
1124158639 15:27250044-27250066 AAGAACAGACAGGAGGATGGAGG - Intronic
1124886987 15:33696398-33696420 CAGGGCAGCCAGCAGGTTGATGG - Exonic
1126101943 15:45123315-45123337 CAGAGAAGCCCCCAGGGTGGTGG - Intronic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1127621187 15:60736290-60736312 CAGAGGTGCTAGCAGCATGGCGG + Intronic
1128344533 15:66845189-66845211 TAGAGCAGCAAACAAGATGGTGG + Intergenic
1128697628 15:69780470-69780492 CAGAGCTGACATCAGGAAGGAGG + Intergenic
1128714573 15:69898399-69898421 CTGAGCAGCCACCAGGCTTGTGG - Intergenic
1129188209 15:73923178-73923200 CAGCGCAGCCTGGAAGATGGAGG + Intergenic
1129305193 15:74655694-74655716 AACAGCAACCAGCAGGATGTGGG + Intronic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1130812101 15:87390434-87390456 CATTTCAGCCAGCAGGATGAGGG - Intergenic
1130955142 15:88622087-88622109 TTGATCAGCCAGCAGGTTGGTGG + Intronic
1131842309 15:96450415-96450437 AAGAGAAGGCAGTAGGATGGGGG - Intergenic
1132221795 15:100110718-100110740 AAGAGCAGCAAGGAGGATGAAGG - Intronic
1132453019 15:101978599-101978621 CAGACCAGCCGGCTGGAGGGAGG - Intergenic
1132453873 16:12027-12049 CAGACCAGCCGGCTGGAGGGAGG + Intergenic
1132485647 16:189378-189400 CTGAGCGGCCAGCAGAAGGGGGG - Intronic
1133018078 16:2954100-2954122 CAGAGGGGCTGGCAGGATGGGGG - Intergenic
1133018780 16:2956763-2956785 CGGGGCAGACAGCAGGCTGGAGG + Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1134225618 16:12387580-12387602 TTGTGCAGCCAGCAGGATGCTGG + Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135994365 16:27237252-27237274 GAGAGCAGGCATCAGGAGGGAGG + Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1137033594 16:35547755-35547777 CACAGCAGCCAGCAGGGAGGAGG + Intergenic
1137538103 16:49342600-49342622 CATGGCAGCCATCAGGATGCAGG + Intergenic
1138067927 16:53961157-53961179 CAGAACAGCCTGCAGGAGAGGGG - Intronic
1139390932 16:66605772-66605794 GAGAGCGGCCAGGAGGGTGGGGG + Intronic
1139614915 16:68083140-68083162 CAGACCAGACAGCAGGCAGGAGG - Intergenic
1139630864 16:68231177-68231199 CAGGGCAGCTTGCAGGGTGGAGG + Exonic
1139921738 16:70464900-70464922 CAAACCAGCCAGCAAGAAGGTGG + Intronic
1140059183 16:71553220-71553242 CATTGCAGCCAGCAGGAATGTGG - Intronic
1140732115 16:77865787-77865809 CAGTGCAGCTGGCAGGATGTGGG + Intronic
1141643980 16:85357601-85357623 CAGAGCAGCCGGGAGGAGGACGG + Exonic
1141651123 16:85393798-85393820 CAGCCCAGCCACCAGGCTGGGGG - Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141729180 16:85810364-85810386 TAGAGGATCCAGCAGGGTGGAGG + Intergenic
1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG + Intergenic
1142105919 16:88302725-88302747 CAGAGCAGCCAGCAGGGACAGGG - Intergenic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143366902 17:6414449-6414471 CTAAGCAGCCAGCATGGTGGTGG - Intronic
1143479337 17:7219654-7219676 CACTGCAGCCAGAGGGATGGAGG - Exonic
1144006038 17:11100499-11100521 CAGAGCAGCAACAAGGATTGTGG + Intergenic
1144753422 17:17665702-17665724 CCCACCAGCCAGCAGGATAGGGG + Intergenic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145013593 17:19383188-19383210 CAGGTCAGCCAGCAGCATTGGGG - Exonic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146351812 17:32101691-32101713 CAGACCAGGCAGCAGAATGGAGG - Intergenic
1146756707 17:35439037-35439059 CATAGGTGCCAGCAGGGTGGGGG + Exonic
1146821685 17:35987936-35987958 CACATCAGCAAGCAGAATGGGGG - Intronic
1147250588 17:39150889-39150911 GGGAGCAGCCAGGGGGATGGTGG - Intronic
1147656739 17:42095431-42095453 AAGGGCAGCCAGAGGGATGGTGG + Intergenic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148191288 17:45680537-45680559 CAGAGCAGGAATCAGGACGGAGG - Intergenic
1148683009 17:49485497-49485519 CAAAGCAGCCAGGAGGAGCGAGG + Intergenic
1148907606 17:50921152-50921174 CAGGGCAGCCTGCAGGACAGAGG - Intergenic
1149869217 17:60167819-60167841 CAGACCAGGCAGCAGAATGGAGG - Intronic
1149885594 17:60336867-60336889 CAGAACAACCAGCAGGATACTGG - Intronic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1150212811 17:63450720-63450742 CAGAGCAGCCAGCAGCACAGCGG + Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150466291 17:65395602-65395624 CATTGCAGCCAGCAGGAAGGAGG - Intergenic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1150588558 17:66540498-66540520 CAGAGCAGTCAGTTGGGTGGCGG + Intronic
1151310793 17:73291375-73291397 CAGGCCACCCAGCAGGATTGAGG + Intronic
1152670274 17:81599994-81600016 CAGAGGAGCCAGCAGGGGTGCGG + Intronic
1152693401 17:81732087-81732109 CCGGGCAGCCGGCAGGTTGGGGG - Intergenic
1153534048 18:6081238-6081260 AGGAGGAGCTAGCAGGATGGTGG + Intronic
1153756581 18:8289725-8289747 CAGAGCAGCCATCATGATCTCGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154301996 18:13202676-13202698 CAGTGCAGCCACCAGTATGCTGG - Intergenic
1156256121 18:35398241-35398263 CAGAGCATCCTGGAGGCTGGAGG + Intergenic
1157342870 18:46794901-46794923 CAAACCAAGCAGCAGGATGGAGG - Intergenic
1157491106 18:48124498-48124520 CAGAGGAGCCAGCTGGAAGGGGG + Intronic
1157544410 18:48538039-48538061 TGGAGCAGCCAACTGGATGGAGG - Intergenic
1157555510 18:48610568-48610590 GAGAGCAGCCCGCAGGAGTGTGG - Intronic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1158524209 18:58197814-58197836 CAGAGCAGCCTGTTGGGTGGAGG + Intronic
1160199953 18:76788160-76788182 CAGACCAATCAGCAGGATGTGGG - Intergenic
1160974245 19:1784897-1784919 CAGGACCACCAGCAGGATGGAGG + Exonic
1160983902 19:1828671-1828693 GAGAGGAGCCCGCAGCATGGGGG + Intronic
1161169635 19:2806357-2806379 CAGAGCAGCCAGCCAAATAGGGG - Intronic
1161362112 19:3856204-3856226 CGGGGAAGCCAGCAGGATGAAGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161511190 19:4672692-4672714 CAGAACAGACAGCTGCATGGAGG - Intergenic
1161570074 19:5025636-5025658 CAGAGGAGGCGGCAGGATCGAGG - Intronic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162432057 19:10635059-10635081 CAAAGAAGCCAGCAGGTGGGGGG + Exonic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1163309443 19:16504469-16504491 CAGGGCAGCCAGCCAGCTGGGGG - Intronic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163602477 19:18257408-18257430 CAGGGCAGCCAGCTGGTAGGCGG + Exonic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165052503 19:33150958-33150980 CAGAGCTGCCAGTCTGATGGAGG - Intronic
1165472177 19:36010033-36010055 CAGAGCATCCAGGAGCATGCAGG + Intronic
1165846740 19:38822772-38822794 CGGACCAACCAGCAGGATGTGGG + Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166793131 19:45409599-45409621 CAGCGCAGCCAGCAGGAGCCTGG + Exonic
1167149291 19:47699536-47699558 CACAGCTGCCAGCAGGAAGGTGG - Intronic
925237724 2:2293764-2293786 CAGAGGAGCCGGGAGGAGGGAGG - Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
925451453 2:3973044-3973066 CACAGCAGGCAGGAGGGTGGTGG + Intergenic
926196883 2:10769298-10769320 CAGAACAGTCACCAGGATGGTGG + Intronic
926299156 2:11589835-11589857 CTGAGCAGCCAGGTGAATGGTGG + Intronic
926400524 2:12491762-12491784 CAGAGGTGCCAGCATGGTGGGGG - Intergenic
927184728 2:20474010-20474032 CAGGGCAGCAAGCAGCCTGGTGG - Intergenic
927497937 2:23563268-23563290 CCGAGCAGCCAGCACGATGGAGG - Intronic
927870587 2:26620376-26620398 CTGAGCAGCCTGTAGGTTGGCGG - Intronic
928287392 2:30004760-30004782 CAGAAGAGCCAGCACGAAGGAGG - Intergenic
928949115 2:36798957-36798979 CACAGCAATCAGCAGAATGGGGG - Intronic
930122054 2:47768422-47768444 CAGAGGGGCCAGGAGGGTGGTGG - Intronic
930227535 2:48809499-48809521 CATTACAGCCAGCAGGATGGAGG - Intergenic
933720531 2:85394831-85394853 CAGAGAAGCAAGCAGGCAGGTGG + Exonic
934047906 2:88187102-88187124 CACAGCAGCCTCCAGGGTGGCGG - Intergenic
934938662 2:98483741-98483763 CAGAGTAGCCAACAGGAAGGTGG - Intronic
935443787 2:103135555-103135577 CAGGTCAGCCAGCAGGGTGAAGG + Intergenic
936065492 2:109328973-109328995 CAGAGCAGCCACCAGGACGTGGG - Intronic
936238388 2:110766495-110766517 CTGAGCTGCCATCAGGAAGGGGG + Intronic
936569235 2:113601071-113601093 CAGACCAGCCGGCTGGAGGGAGG - Intergenic
936610706 2:113999496-113999518 CAGCACAGCCTGGAGGATGGAGG + Intergenic
936651117 2:114427023-114427045 GTGAGCACCCAGCAAGATGGCGG - Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937259243 2:120574884-120574906 CAGAGCAGACACCTGGATGAAGG - Intergenic
938370395 2:130764521-130764543 TTGAACAGCCAGCAGGAAGGGGG + Exonic
938420108 2:131138862-131138884 GACACCACCCAGCAGGATGGGGG + Intronic
938576099 2:132606046-132606068 CAGAGCAGCAAGCGGGAGGAGGG + Intronic
938668755 2:133566699-133566721 AAGAGCACCCAGTAAGATGGTGG - Intronic
940099722 2:150020734-150020756 GAGAGCTGTCAGCTGGATGGTGG + Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941893342 2:170605241-170605263 AAGAGCAGCCATGAGGCTGGGGG - Intronic
941957279 2:171217533-171217555 AAAAGCAGACAGCAGGAGGGAGG + Intronic
942244764 2:173997435-173997457 CTGAGCAGCCAGAAGCATGCAGG - Intergenic
942449734 2:176101288-176101310 CAGGGCAGACAGGAGGGTGGAGG - Intergenic
944646836 2:201788554-201788576 CAGAGAACCCAGCAGGATCTTGG - Intergenic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945398314 2:209348794-209348816 CAAAGCAGACAGCAGGAGGGAGG - Intergenic
946186015 2:217980776-217980798 CAGAGCAGGGAGCATGCTGGAGG - Intronic
947617626 2:231568632-231568654 GAGAGCAGCATGCAGGAAGGGGG - Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948051929 2:234985065-234985087 CGGGTCAGCCTGCAGGATGGAGG - Intronic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948851627 2:240711162-240711184 CAGAGCAGGCAGGAAGCTGGGGG + Intergenic
948860952 2:240752377-240752399 CGGAGCACCCAGCAGGACTGTGG - Intronic
948880561 2:240855242-240855264 AAAAGCAGCAAGCAGCATGGAGG - Intergenic
949045413 2:241870520-241870542 CGGACCAGCCAGCAGCCTGGGGG - Intronic
1168841249 20:911387-911409 CTGAGCAGCCAGCTGCAGGGTGG + Intronic
1169970529 20:11265219-11265241 CAGAGCAGCCCCCAGGATGAAGG - Intergenic
1170447327 20:16441704-16441726 AAGTGCACCCAGCAGGATAGAGG - Intronic
1170921389 20:20683078-20683100 CAGAGCAGCGGGGTGGATGGAGG - Intronic
1171004765 20:21453663-21453685 CAGAGAAGACAGCAGGAAAGAGG + Intergenic
1171445409 20:25199229-25199251 CAGAGCAGCCAGCAGCACAAGGG + Intronic
1172084303 20:32367681-32367703 CAGTGCAGACAGCAGCATGATGG - Intronic
1172133771 20:32673624-32673646 CAGAGGAGCCTGCAGGTGGGTGG - Intergenic
1172773322 20:37393811-37393833 CACAGCACCTAGGAGGATGGTGG + Intronic
1172948040 20:38703634-38703656 CAGGGCATGCAGCAGGGTGGTGG - Intergenic
1172950435 20:38720014-38720036 CAGAGCAGACAGCACCATGGGGG - Intergenic
1173415023 20:42847444-42847466 CAGGGCAGTGAGCAGGGTGGAGG + Intronic
1173649765 20:44655740-44655762 CAGAGCAGCGTGCAGAAGGGTGG - Intergenic
1173872431 20:46350440-46350462 CGGAGCAGCCAGCGGGAGGAAGG - Exonic
1173916740 20:46713659-46713681 CACAGCAGCCAGAAGGATTCTGG - Intronic
1175946232 20:62560129-62560151 CAGAGCAGGGGGCAGGCTGGGGG - Intronic
1176019348 20:62954578-62954600 CCGCGCCCCCAGCAGGATGGAGG + Intronic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1178633002 21:34278871-34278893 CAGAGAAGCTTGCAGGAGGGTGG - Intergenic
1178902054 21:36606037-36606059 CAGGGCATCCTGCAGGGTGGAGG - Intergenic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179485173 21:41705442-41705464 CTGAGCAGCCATGAGGGTGGAGG + Intergenic
1179822702 21:43945941-43945963 AGGAGAAGCCAGCAGGAGGGTGG + Intronic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1179944037 21:44658628-44658650 CAGCTCAGCCATCAGGAAGGTGG - Intronic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180074747 21:45456743-45456765 CAGAACTGGCAGCAGGGTGGCGG - Intronic
1180193983 21:46182686-46182708 CAGAGCTGCCAGGAGGGCGGCGG - Exonic
1180216333 21:46325371-46325393 CAGAGCTCCCAGGAGGGTGGAGG + Intronic
1180730026 22:17974210-17974232 CAGGGCAGACAGCAGGGTGGTGG - Intronic
1180898264 22:19353114-19353136 CAGGACAGGCAGCAGGACGGAGG - Intronic
1180955790 22:19740649-19740671 CAGAGCTGCTGGCAGGGTGGGGG + Intergenic
1180984273 22:19895294-19895316 CCTGGCAGCCAGCAGGATGGGGG + Intronic
1181063136 22:20291484-20291506 CTGAGCAGGTAGCAGGGTGGGGG - Intergenic
1181173393 22:21022773-21022795 CAGTGCCCCCAGCAGGGTGGGGG + Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181667511 22:24408351-24408373 CAGAGCAGAGAGCCGCATGGAGG + Intronic
1182771794 22:32801704-32801726 CAGAGCGGGCAGCAGGCAGGCGG + Exonic
1183323400 22:37178508-37178530 CAGACCTGGCAGCAGGATTGGGG + Intergenic
1183827181 22:40397689-40397711 CAAGGCAGCCAGCAGGCTGGAGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184020934 22:41821029-41821051 AGGAGCAGTCAGCATGATGGTGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184721389 22:46316113-46316135 CAGAGCTGGCCGCAGCATGGCGG - Exonic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1184841636 22:47055656-47055678 CAGAGCAGCCAGCATGGAGAGGG + Intronic
1184918104 22:47587104-47587126 CAGGACAGCCAGCAGGAGAGAGG - Intergenic
949114323 3:301416-301438 CAGAACAGCCAGTAGGAGGTTGG - Intronic
949965829 3:9355448-9355470 CAGAGGAGTGAGCAGGATAGAGG - Intronic
950127049 3:10516229-10516251 CAGGGCAGCCTGCAGCAGGGAGG - Intronic
950407969 3:12816410-12816432 CAGGGCATCCATCCGGATGGTGG - Exonic
950614469 3:14148028-14148050 CAGAGCAGGCAGCAGGTTCGAGG - Intronic
951325794 3:21300848-21300870 GAGAGCAGCCAGTAGAATTGGGG + Intergenic
952490909 3:33871750-33871772 CAGAGAAGCCCACAGGCTGGAGG - Intergenic
952978965 3:38719918-38719940 CAGCGAAGCCATCAGGAAGGGGG - Intronic
953548796 3:43884686-43884708 GAGAGTAGCCAGCAGGAAGTGGG - Intergenic
953670558 3:44958766-44958788 CAGAGCAGAAAGCATGCTGGAGG - Intronic
954621471 3:51998447-51998469 AAGAGAAGCCAGCAGGGTAGAGG + Intergenic
955781302 3:62487385-62487407 CACAGCTGCCAGAAGGATTGTGG + Intronic
958556866 3:95690384-95690406 CAGAACAGCGAGCATGAAGGAGG - Intergenic
961201991 3:125052739-125052761 CTGAACAGCCAGCAGGGTGACGG + Intronic
961351412 3:126307004-126307026 AAGAGCAGCCTGGAGTATGGGGG - Intergenic
961561466 3:127733343-127733365 CAGAGCAGCCTGAGGGCTGGTGG - Intronic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
962414011 3:135166436-135166458 CTCAGCAGCCAGCAAGAGGGAGG + Intronic
964472129 3:157067177-157067199 CAGAGCAGCCCACAGGCAGGCGG - Intergenic
965330172 3:167362987-167363009 CACAGTAGCCAGCATGTTGGAGG - Intronic
965773092 3:172201291-172201313 GAGAGCAGCCAGAAGCAGGGTGG - Intronic
966862118 3:184236398-184236420 CAGAGCAGCCAGCACGTCTGGGG - Exonic
966868813 3:184276962-184276984 CAGTGCAGCCAGCAGTAGAGAGG - Exonic
968531344 4:1093581-1093603 CAGAGCAGACAGGTGGCTGGAGG + Intronic
968589230 4:1449492-1449514 CAGATCAGCCTGCAGGGTGTGGG - Intergenic
968739831 4:2321878-2321900 CAGGGCAGTCAGCAGGAGTGGGG + Intronic
969077649 4:4593060-4593082 CACTGCAGTCAGCAGAATGGTGG - Intergenic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969158688 4:5236019-5236041 CAGAGCAGCCAGGAGGGGGTGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969560100 4:7941357-7941379 CTGAGCAGCTAGGTGGATGGAGG - Intergenic
970424855 4:15936582-15936604 CTGAGCAGCCAGTAGGAGGAAGG + Exonic
970492094 4:16585067-16585089 CAGAGCAGCCTTCTGGATTGTGG + Intronic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
971554981 4:28002278-28002300 CAGACCAGCCTGTAGGATGGTGG - Intergenic
973209354 4:47598686-47598708 CAAATCAGCCAGCATGAAGGTGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
978282336 4:107034186-107034208 CAGCGCAGCCAGCCGGCTGAAGG - Intronic
979621540 4:122804070-122804092 GAGAGCAGGCAGCAGAAGGGTGG + Intergenic
980687056 4:136242089-136242111 GAGAGCAGCCAGCAGAATTAGGG + Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
983675643 4:170289207-170289229 GAGAGCTGCCTGCAGGATGAGGG - Intergenic
983900582 4:173129174-173129196 AAGAACAGCCAGCAAGATGTGGG + Intergenic
985335134 4:188884241-188884263 CAGAAGAGCCAGCAGGATTGAGG - Intergenic
985728192 5:1526557-1526579 CACAGCACCCTGCAGGGTGGTGG - Intergenic
985895372 5:2747651-2747673 CTGCGCAGCCAGCAGGCTGTGGG - Intronic
985985304 5:3510752-3510774 CAGGGCTGGCAGCAGGATGGGGG + Intergenic
986718522 5:10541234-10541256 CCAAGAAGCCAGCAGGGTGGAGG + Intergenic
987421105 5:17720747-17720769 CAGAGCAGCCAGCACCACAGTGG - Intergenic
988503040 5:31799306-31799328 CAGAACAGCCTGCAGGAAGGTGG + Exonic
991946490 5:71902835-71902857 CCTACCAGACAGCAGGATGGAGG + Intergenic
993018717 5:82564837-82564859 CAGTGCAATCAACAGGATGGGGG - Intergenic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994292849 5:98050570-98050592 CATAGCAGACAGCAAGATGGGGG + Intergenic
994647639 5:102490971-102490993 TGGAGCAGTCAGCAGGATGTGGG - Intronic
995527048 5:113058590-113058612 CAGGGCAGCCAGGAGCATTGTGG - Intronic
995801139 5:115996740-115996762 TAGATCAGGCAGCAGGAAGGTGG - Intronic
997819923 5:137056134-137056156 CACAGCAGCCAACAGGCTGTAGG + Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998025837 5:138815479-138815501 CAGGGCACCCAGCAGGAAAGAGG - Intronic
998161381 5:139814662-139814684 CAGAGAAGCCAGCAGGAGCTGGG + Intronic
999016127 5:148107533-148107555 AGGAGAAGCCAGCTGGATGGAGG + Intronic
999203491 5:149832743-149832765 CAGTGCTGCCTGCAGGATCGGGG + Exonic
999261142 5:150239623-150239645 CAGTGCAGCCTGCAGGAGGGAGG + Intronic
1000161621 5:158602980-158603002 CAAAGCAGGCCGCTGGATGGAGG + Intergenic
1001541448 5:172542704-172542726 CCGGGGCGCCAGCAGGATGGTGG - Intergenic
1001875667 5:175198283-175198305 CAGAGCAGCGGGCGGGGTGGGGG - Intergenic
1002299968 5:178252469-178252491 CAGAGCAGACAGGAAGAGGGAGG + Intronic
1002494950 5:179605467-179605489 GACAGCAGGCAGCAGAATGGAGG + Intronic
1002548130 5:179966001-179966023 CAGAGCAGCAACCAGGAAGATGG + Intronic
1002593548 5:180307101-180307123 CTGAGGAGCCAGCGGGAAGGAGG - Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002884741 6:1283204-1283226 CACTCCATCCAGCAGGATGGAGG - Intergenic
1003896888 6:10616444-10616466 CAGACCAATCAGCAGGATGTGGG - Intronic
1004622242 6:17341274-17341296 CGGACCAACCAGCAGGATGTGGG - Intergenic
1005426673 6:25710193-25710215 CAGAACAGCCAGGAGGATTCGGG - Intergenic
1006068027 6:31476609-31476631 CAGTGCAGGGGGCAGGATGGAGG - Intergenic
1006586396 6:35117388-35117410 TGGAGAAGCCAGAAGGATGGAGG + Intergenic
1006911780 6:37567959-37567981 CACAACAGCCAGCAGGAAGGAGG + Intergenic
1007194734 6:40050874-40050896 CAGAGCAGCTATCAGCATGGTGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008392915 6:50973590-50973612 CTGAGCAGCCTGCAGAATGTAGG - Intergenic
1010443020 6:75919971-75919993 CAGAGGACCCAGCAGGATCATGG - Intergenic
1011715306 6:90098874-90098896 CAGAGTAGCCAGCTGAATTGGGG - Intronic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1011974871 6:93283331-93283353 CAGACCAATCAGCAGGATGTGGG + Intronic
1014770404 6:125453076-125453098 CAGAGCAGGCACCAGGAGTGGGG - Intergenic
1015494330 6:133865068-133865090 CAGTGTAGTCAGCAAGATGGAGG + Intergenic
1018432185 6:163730988-163731010 CACAGCAGGAAGCAGGAGGGAGG + Intergenic
1018522535 6:164666614-164666636 CAAAGGAGCGAGCAGCATGGTGG - Intergenic
1018614286 6:165671501-165671523 CACAGCAGCCAACGGGAAGGTGG - Intronic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019338598 7:496706-496728 CAGGGCAGCCTGGAGGCTGGAGG - Intergenic
1019446693 7:1074938-1074960 CGGGGCAGCCACCAGGCTGGAGG - Intronic
1019543736 7:1562917-1562939 CACAGGAGCTAGCTGGATGGCGG + Intergenic
1020401269 7:7780279-7780301 CAGAGGAGCCAGCAGGAAATGGG - Intronic
1020432957 7:8132229-8132251 CAGAGCAGGCTTCAGGAAGGAGG - Intronic
1020608142 7:10363020-10363042 CATAGAAGCAACCAGGATGGGGG + Intergenic
1022363324 7:29684868-29684890 CACAGCAGCCCTGAGGATGGCGG - Intergenic
1022698062 7:32728889-32728911 CACAGCAGCCCTGAGGATGGCGG + Intergenic
1023365357 7:39458189-39458211 CTGAGCAGGGAGCAGGTTGGAGG + Intronic
1023366399 7:39468284-39468306 CGGAGCAGGCAGCAGGAGGGAGG + Intronic
1023382590 7:39623585-39623607 CAGAGCCGCCAGGAGGAGGGTGG + Exonic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1026443646 7:70465205-70465227 CTGAGCAGAAAGCAGGTTGGAGG + Intronic
1026791504 7:73335503-73335525 TGGAGCAGACAGCAGGAAGGTGG - Intronic
1027541918 7:79477567-79477589 CACAGCTGCCAGCAAGATGTCGG - Intergenic
1027779071 7:82500378-82500400 CAGACCAATCAGCAGGATGTGGG + Intergenic
1028378966 7:90176825-90176847 CAGAGCAGGCACCAGGAGTGGGG + Intronic
1028556683 7:92133711-92133733 CAGGGCAGCCTCCAGGATGACGG + Intronic
1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG + Intronic
1029496786 7:100899644-100899666 CATTCCAGCCAGCAGGAAGGAGG + Intergenic
1029877309 7:103767899-103767921 AAGAGCATACAGCTGGATGGAGG - Intronic
1031527788 7:122842273-122842295 TAGAGCAGAAAGCAGGACGGAGG + Intronic
1031978460 7:128108305-128108327 CAGGGCAGAGAGCAGGGTGGAGG + Intergenic
1032394874 7:131582040-131582062 CAGAGGAGCCAGGAGGGAGGGGG - Intergenic
1032934047 7:136708767-136708789 CAGAGCTTCTAGCAGAATGGTGG + Intergenic
1033411217 7:141119400-141119422 CTGAGGAGCCCTCAGGATGGGGG + Intronic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1034170434 7:149058826-149058848 CAAAGCAGCCTGCAGGCTGAGGG + Intergenic
1034244251 7:149632624-149632646 CTGAGCACCCGGCGGGATGGGGG - Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034563191 7:151894670-151894692 CAGAGAAGCCAGGAGGGCGGAGG - Intergenic
1034563203 7:151894721-151894743 CAGAGGAGCAGGGAGGATGGAGG - Intergenic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1035205617 7:157292196-157292218 CAGAACAGTCAGCAGGACAGGGG - Intergenic
1035289009 7:157825257-157825279 CATTTCAGCCAGCAGGAAGGGGG - Intronic
1035604630 8:921698-921720 CAGCGCAGCCACCTGGGTGGAGG - Intergenic
1037109165 8:15145135-15145157 CAGAGAAGCCAGAAGGACTGAGG - Intronic
1037638470 8:20721524-20721546 AAAAGCAGAAAGCAGGATGGAGG - Intergenic
1037755100 8:21705319-21705341 CAGAGGGGCCAGCAGCATAGAGG + Intronic
1038122011 8:24627854-24627876 CAGAGCACCAGGCAGCATGGAGG - Intergenic
1038613680 8:29074345-29074367 CAAAGCAGGGAGCAGGATGGTGG + Intronic
1039514309 8:38119311-38119333 AAGCGCAAACAGCAGGATGGAGG + Exonic
1039759827 8:40562548-40562570 GACAGCACCCAGGAGGATGGAGG - Intronic
1041426363 8:57725202-57725224 CAGGGCAGCCAGGAGAACGGAGG + Intergenic
1042347072 8:67738329-67738351 CAGTCCAGCCAGCAGGAAAGTGG - Intronic
1043297415 8:78683081-78683103 GAAAGCAGCCAGGAGGAGGGGGG - Intronic
1044849860 8:96417720-96417742 AAGAGAAGCCCCCAGGATGGGGG - Intergenic
1045227082 8:100259227-100259249 CAGAGAAGGCAACAGTATGGAGG - Exonic
1048329154 8:133460564-133460586 CAGTACAGCCAGCAGGGTGCTGG - Intronic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048804332 8:138225846-138225868 CATAGCAGCTGGCAGGGTGGTGG + Intronic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1049410658 8:142472435-142472457 AGGAGCAGCAAGCAGGCTGGGGG - Intronic
1049444066 8:142622016-142622038 AAGCGCAGCCATCAGGGTGGGGG - Intergenic
1049657317 8:143804592-143804614 CGCGGCAGCCAGCAGGCTGGGGG + Exonic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1049733781 8:144192607-144192629 CATAGCAGCCCCCAGGATGGAGG + Intronic
1049759013 8:144323489-144323511 CAGTGCGGCCAGCAGCATGTGGG + Intronic
1049782322 8:144434677-144434699 CACAGCACCCACCAGGCTGGGGG + Intronic
1049883292 9:12459-12481 CAGACCAGCCGGCTGGAGGGAGG + Intergenic
1049957182 9:704401-704423 CATTCCAGGCAGCAGGATGGAGG + Intronic
1050461996 9:5885069-5885091 CCCAGCAGCCAGGAGGGTGGAGG - Intronic
1050483823 9:6113998-6114020 TACTGCAGCCAGCATGATGGTGG - Intergenic
1050732330 9:8723218-8723240 CAGAGCATCCAGGCAGATGGGGG - Intronic
1052313565 9:27093519-27093541 CAGACCAATCAGCAGGATGTGGG + Intergenic
1052766896 9:32650669-32650691 TGGAGCACCCAGCAGGAGGGTGG + Intergenic
1053131614 9:35618679-35618701 CAAGGCAGCCAGGAGGAGGGTGG - Intronic
1055486915 9:76765246-76765268 CAGAGCTTCCAGCAGGTGGGGGG + Intronic
1055980598 9:81996303-81996325 CAGTGCACCTATCAGGATGGAGG + Intergenic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1056948922 9:91026349-91026371 TAGAACACCCAGCACGATGGAGG + Intergenic
1057076753 9:92141996-92142018 CAGAGCAGTGCCCAGGATGGTGG + Intergenic
1057182660 9:93038226-93038248 CACCACAGCCTGCAGGATGGGGG + Intergenic
1057203552 9:93156944-93156966 CATCCCAGCCAGCAGGAAGGAGG + Intergenic
1057220367 9:93254443-93254465 CAGGGCAGCCAGCAGGACAGAGG - Intronic
1057226036 9:93293675-93293697 CCAAGCAGACAGCAGGGTGGGGG - Intronic
1057904127 9:98971349-98971371 CAGAGCTGCCTGCCGGGTGGGGG + Intronic
1058560966 9:106228852-106228874 CAGGGGAGCCAGCAGAAAGGAGG - Intergenic
1059388079 9:113980765-113980787 GTGAGCAACCAGCTGGATGGAGG + Intronic
1059568247 9:115406001-115406023 TAGAGCAGCCCACAGGGTGGTGG - Intergenic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061425241 9:130494403-130494425 CAGTGCAGGCAGCTGGGTGGTGG - Intronic
1061498614 9:130989914-130989936 CAGGGCTGCCTGGAGGATGGCGG + Intergenic
1061574306 9:131496604-131496626 CAGAGCAGCAGGCAGGTTGGGGG + Exonic
1061704701 9:132444065-132444087 CTGAGCAGCCACCAGGGTGAAGG + Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061848573 9:133401786-133401808 AAGAGCACTCAGCAGGGTGGAGG - Exonic
1062196056 9:135274834-135274856 CAGACCAGCCAGCAGGCAGGAGG - Intergenic
1062397110 9:136356959-136356981 CAGGGCTGCCAGCTGGCTGGTGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415714 9:136448541-136448563 CAGAGACGCCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062537887 9:137028760-137028782 CCGAGCAGCCAGCGGAAGGGGGG + Intronic
1062569608 9:137179079-137179101 CAGAGCCGCCAGGAGGCCGGCGG - Intronic
1062574307 9:137199431-137199453 CGAAGCAGCCGGCAGGAAGGGGG + Exonic
1062582482 9:137234673-137234695 CAGGGCAGCCAGCAGGGCTGTGG - Exonic
1062698293 9:137886410-137886432 CTGAGCAGAGGGCAGGATGGTGG - Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186170058 X:6867387-6867409 CAGTGAAGCCAGCATGATGGTGG + Intergenic
1187046645 X:15653840-15653862 CAGAGCAGCCAGTGGGCTGGTGG + Intronic
1187479374 X:19641004-19641026 CAGAGCGGACAGCAGCATAGGGG - Intronic
1190191127 X:48278040-48278062 CTGATCAGGCAGAAGGATGGGGG + Intergenic
1191904187 X:66071434-66071456 CACTGCTGCCAGCAGGATGAAGG + Intergenic
1192363943 X:70455565-70455587 CGCAGCAGCCAGCAGGAAGGGGG - Intronic
1192591210 X:72360970-72360992 GTGAGCAGGCAGGAGGATGGGGG + Intronic
1196576654 X:117325982-117326004 TAGAGCAGCAAGCAGGATCTTGG - Intergenic
1197265613 X:124367136-124367158 CAGATCAGACAACAGGATGAGGG - Intronic
1197549391 X:127870261-127870283 AAGAGCAGACAGCAGAATGGTGG + Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1199721867 X:150547936-150547958 CAGAGCAGGCGGCTGGACGGCGG - Intergenic
1200402521 X:156027689-156027711 CAGACCAGCCGGCTGGAGGGAGG - Intergenic
1201560398 Y:15310174-15310196 CAGAGAAGCCAGGGTGATGGTGG + Intergenic