ID: 1061847389

View in Genome Browser
Species Human (GRCh38)
Location 9:133395304-133395326
Sequence ATGCTCACACTCTGTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061847378_1061847389 9 Left 1061847378 9:133395272-133395294 CCAGCCCCAGCCCAGGCAGTGTG 0: 1
1: 2
2: 7
3: 79
4: 706
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847379_1061847389 5 Left 1061847379 9:133395276-133395298 CCCCAGCCCAGGCAGTGTGACCC 0: 1
1: 0
2: 3
3: 36
4: 410
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847385_1061847389 -2 Left 1061847385 9:133395283-133395305 CCAGGCAGTGTGACCCTGGGCAT 0: 1
1: 0
2: 28
3: 152
4: 687
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847376_1061847389 17 Left 1061847376 9:133395264-133395286 CCTGAGCTCCAGCCCCAGCCCAG 0: 1
1: 1
2: 37
3: 207
4: 1470
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847380_1061847389 4 Left 1061847380 9:133395277-133395299 CCCAGCCCAGGCAGTGTGACCCT 0: 1
1: 0
2: 5
3: 40
4: 304
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847381_1061847389 3 Left 1061847381 9:133395278-133395300 CCAGCCCAGGCAGTGTGACCCTG 0: 1
1: 0
2: 5
3: 33
4: 362
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847375_1061847389 29 Left 1061847375 9:133395252-133395274 CCTGGAAATTAGCCTGAGCTCCA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data
1061847384_1061847389 -1 Left 1061847384 9:133395282-133395304 CCCAGGCAGTGTGACCCTGGGCA 0: 1
1: 0
2: 18
3: 74
4: 426
Right 1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061847389 Original CRISPR ATGCTCACACTCTGTGAAAT GGG Intronic
No off target data available for this crispr