ID: 1061848424

View in Genome Browser
Species Human (GRCh38)
Location 9:133400882-133400904
Sequence GGATCATCAGGAACTTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061848424_1061848431 11 Left 1061848424 9:133400882-133400904 CCTGGACAAGTTCCTGATGATCC No data
Right 1061848431 9:133400916-133400938 CCAGCTATGAAGCGAGGAGCTGG No data
1061848424_1061848432 19 Left 1061848424 9:133400882-133400904 CCTGGACAAGTTCCTGATGATCC No data
Right 1061848432 9:133400924-133400946 GAAGCGAGGAGCTGGACACGAGG No data
1061848424_1061848433 27 Left 1061848424 9:133400882-133400904 CCTGGACAAGTTCCTGATGATCC No data
Right 1061848433 9:133400932-133400954 GAGCTGGACACGAGGTCCTCTGG No data
1061848424_1061848428 5 Left 1061848424 9:133400882-133400904 CCTGGACAAGTTCCTGATGATCC No data
Right 1061848428 9:133400910-133400932 GTTTTCCCAGCTATGAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061848424 Original CRISPR GGATCATCAGGAACTTGTCC AGG (reversed) Intronic