ID: 1061849350

View in Genome Browser
Species Human (GRCh38)
Location 9:133405324-133405346
Sequence GCTGCTGTCACTCACCAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061849350_1061849352 -6 Left 1061849350 9:133405324-133405346 CCAGCCTGGTGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1061849352 9:133405341-133405363 AGCAGCGCCTTCAGCAAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 115
1061849350_1061849363 25 Left 1061849350 9:133405324-133405346 CCAGCCTGGTGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1061849363 9:133405372-133405394 CAGGTGGAAGCCCCCAGCTGGGG 0: 1
1: 0
2: 1
3: 44
4: 352
1061849350_1061849354 6 Left 1061849350 9:133405324-133405346 CCAGCCTGGTGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1061849354 9:133405353-133405375 AGCAAACCAGGCCTCCCTCCAGG 0: 1
1: 0
2: 0
3: 23
4: 204
1061849350_1061849360 23 Left 1061849350 9:133405324-133405346 CCAGCCTGGTGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1061849360 9:133405370-133405392 TCCAGGTGGAAGCCCCCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 218
1061849350_1061849355 9 Left 1061849350 9:133405324-133405346 CCAGCCTGGTGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1061849355 9:133405356-133405378 AAACCAGGCCTCCCTCCAGGTGG 0: 1
1: 0
2: 3
3: 30
4: 253
1061849350_1061849362 24 Left 1061849350 9:133405324-133405346 CCAGCCTGGTGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1061849362 9:133405371-133405393 CCAGGTGGAAGCCCCCAGCTGGG 0: 1
1: 0
2: 0
3: 25
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061849350 Original CRISPR GCTGCTGTCACTCACCAGGC TGG (reversed) Exonic
900110948 1:1005365-1005387 GCTGCTGTCCCTCAGCTGCCGGG + Intergenic
900149383 1:1171539-1171561 GCTGCTGTGGCTCTCCAGGCTGG - Intergenic
900416027 1:2535057-2535079 GCATCTGTGAATCACCAGGCAGG + Intergenic
901774480 1:11550707-11550729 GCTGCTGGAAATCACAAGGCTGG - Intergenic
902776869 1:18680427-18680449 GCGCCTGTCACACACAAGGCTGG + Intronic
903117243 1:21188388-21188410 GCTGGCGTCAAGCACCAGGCTGG + Intergenic
904407907 1:30305677-30305699 TCGGCTGTCACACAGCAGGCTGG - Intergenic
905891091 1:41518862-41518884 GCTGGTGACACTCATCAGGCAGG + Intronic
905942788 1:41877309-41877331 GCTGCTGTCACTCAGCCAGAAGG + Intronic
909033307 1:70567336-70567358 ACTGCTGCCCCTCACTAGGCAGG + Intergenic
909109956 1:71462500-71462522 GATGCTCACAGTCACCAGGCTGG - Intronic
911128016 1:94359411-94359433 GCTGGTATCACTCCCCAGGCTGG - Intergenic
912489724 1:110055464-110055486 CCTGCTGTCCCTAACCATGCTGG - Intronic
913252090 1:116920090-116920112 CCTGTTGTCTCTCACCTGGCTGG + Intronic
913279461 1:117172116-117172138 GCTGATGTTACTCAATAGGCAGG + Intronic
915628816 1:157136358-157136380 GCTTGTGTCTCTCAGCAGGCGGG - Exonic
915699313 1:157775774-157775796 GATGCAGTCACTGAACAGGCAGG - Exonic
915926411 1:160023694-160023716 ACTGCTTTCACTCAGCAGGGAGG + Intergenic
916650123 1:166827530-166827552 GCTGCAGTCAGACACCAGGTTGG + Intergenic
917978522 1:180255127-180255149 GCTGCCGCCTCCCACCAGGCTGG - Intronic
918587267 1:186202518-186202540 GCTGCAGTTAATCAGCAGGCTGG - Intergenic
921368093 1:214393919-214393941 GCTGCTGAAATTCAGCAGGCTGG - Intronic
1063120281 10:3101064-3101086 GCTGCTGTGACACCGCAGGCTGG + Intronic
1064463289 10:15555559-15555581 GCTGCTGACCCTCTCCAGACTGG - Intronic
1065918551 10:30371676-30371698 GGTGCTGTGACTCACCTTGCCGG - Intronic
1069717999 10:70532973-70532995 GCTGCTCTCCCTCACCTGGCAGG + Exonic
1069773841 10:70915540-70915562 TCTGCACCCACTCACCAGGCTGG - Intergenic
1071814660 10:89220242-89220264 GCTGCTGGCAGTCACTAAGCTGG + Intronic
1072819267 10:98539990-98540012 ACTGCTGTCACTGACCAGGCAGG - Intronic
1073624829 10:105086221-105086243 GCTGCTGTGATTGACCAGCCTGG + Intronic
1074831768 10:117254537-117254559 GCCGCTGTCCAGCACCAGGCAGG - Intronic
1075227764 10:120645017-120645039 CCTGCTATCACTCCCTAGGCGGG - Intergenic
1075642564 10:124075345-124075367 CCTGCTGTCTCTCCCCAGCCAGG + Intronic
1075744595 10:124717963-124717985 GCTCCAGTCACTCAGCAGGCAGG + Intronic
1076541736 10:131219333-131219355 TCAGCTGTCACTCCCCAGGAGGG + Intronic
1077439117 11:2560052-2560074 GCTGCTATCTGTCCCCAGGCTGG - Intronic
1078668041 11:13342068-13342090 GGTGCTGCCTCTCCCCAGGCAGG - Intronic
1079259096 11:18860604-18860626 GCTGCTGTTATTCACCCGGATGG - Intergenic
1082046381 11:47732430-47732452 GCTGCTCTCAGTCTCCAGACAGG + Intronic
1082870733 11:57942199-57942221 ACAGCTGTCACTCACCAAGTGGG - Intergenic
1083610856 11:64003614-64003636 GCGGCTGTAAATCACCACGCAGG - Intronic
1083782914 11:64927189-64927211 GCCGCTGTCAATAACCAAGCTGG + Intronic
1084191695 11:67502340-67502362 GCTGCTGCCCCCCATCAGGCAGG + Exonic
1084195404 11:67521721-67521743 CTTGGTCTCACTCACCAGGCAGG - Intronic
1084627880 11:70322850-70322872 TCTGCTGTTACTCCCCAGCCAGG + Intronic
1085432917 11:76471115-76471137 GCTCCTGTAACAAACCAGGCAGG - Intronic
1085450147 11:76626991-76627013 CCTGCTGCCACTCACCAAGGGGG + Intergenic
1085769864 11:79315178-79315200 GCTGCAGTAAGTCACCAGGCAGG + Intronic
1086089449 11:82991059-82991081 GGTCCTGCCACTCACCAAGCGGG + Intronic
1090257130 11:125292662-125292684 GCAGCTTTCACTCACGAGGCTGG + Intronic
1090314908 11:125777682-125777704 GCTGATGTCCCTTACCTGGCAGG - Intronic
1090645100 11:128760886-128760908 GCTGCTGGCTTGCACCAGGCAGG - Intronic
1090805559 11:130199958-130199980 GCTGCGGTCATTCACGAGACAGG + Exonic
1094482572 12:30896408-30896430 GCTTCTATGGCTCACCAGGCAGG - Intergenic
1095985588 12:47997523-47997545 GCTGCTTGCACTTACCTGGCTGG - Intronic
1096651762 12:53065342-53065364 GCTGCTGTCATACCCCTGGCAGG - Exonic
1099684873 12:85871861-85871883 GCTTCTCTCTGTCACCAGGCTGG - Intergenic
1100688443 12:97012119-97012141 AATGCTGCCACTCACCTGGCAGG - Intergenic
1101505539 12:105342745-105342767 GCTCCTGTCACTCATCACTCAGG + Intronic
1101579298 12:106027422-106027444 TGTGCTGTCACTAACAAGGCTGG - Intergenic
1101898022 12:108770301-108770323 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1101898072 12:108770450-108770472 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1103403842 12:120661016-120661038 GCTGCTGCCAATCGCCATGCTGG + Intronic
1103763701 12:123268002-123268024 GCTGCAGTCAGTGACCAAGCAGG + Intronic
1104553762 12:129780996-129781018 GCTGCTGTCACCCCCCAGCAGGG - Intronic
1104684846 12:130778067-130778089 CCCCCTGTCACTCACCAGCCAGG + Intergenic
1104710430 12:130982056-130982078 GATGCTGTCACTCACCTGGGGGG - Exonic
1105701922 13:22940481-22940503 GCGGCTCTCACTCCACAGGCTGG - Intergenic
1105854554 13:24362287-24362309 GCAACTGTCACTCCACAGGCTGG - Intergenic
1106544585 13:30718919-30718941 GCTGCTGTCACTCAAGATGAAGG - Intronic
1112056810 13:95696525-95696547 GATGCTGTCACTCACCATTGTGG + Intronic
1114543787 14:23483450-23483472 GCTGCTGTTGCTCTGCAGGCAGG + Intronic
1117793734 14:59368804-59368826 GCTGCTGTCAGTCATCTGGTTGG - Exonic
1118059297 14:62117484-62117506 GCGGCTGTCACTCTTCAGTCGGG - Intergenic
1122153623 14:99737753-99737775 GCGGCTGTCACCCACCCAGCAGG - Intronic
1122251295 14:100441644-100441666 GCTTCAGTAACTCAGCAGGCAGG - Intronic
1122332412 14:100931890-100931912 GCCTCTGTCTGTCACCAGGCAGG + Intergenic
1202940773 14_KI270725v1_random:143475-143497 GGTGCTGTCACTGCCCAGCCAGG + Intergenic
1125458556 15:39886322-39886344 ACTGCTGACACTCAGCAGGAGGG - Intronic
1125925595 15:43560369-43560391 GCTGCTGCCACTACCCTGGCTGG - Intronic
1125938740 15:43659920-43659942 GCTGCTGCCACTACCCTGGCTGG - Intronic
1126574129 15:50181617-50181639 CCTGCCCTCACTCACCTGGCAGG + Intronic
1126822212 15:52515437-52515459 ACTGATGTCATTCACCAGACAGG + Intronic
1127502963 15:59571740-59571762 CTTGCTGTCACACAACAGGCAGG - Intergenic
1127873487 15:63092426-63092448 GCTGGGCTCACACACCAGGCAGG - Intergenic
1129893922 15:79090046-79090068 GCCGCAGTCACTCGCCTGGCTGG + Intronic
1130025716 15:80268971-80268993 GCTGAAGTCATGCACCAGGCTGG + Intergenic
1130109571 15:80953557-80953579 TCTGCTCTCCCTCACCAGCCTGG + Intronic
1130238285 15:82160186-82160208 GCTGCAGCCAATCACCATGCAGG + Intronic
1132220949 15:100105128-100105150 GCTGTTGCCACCCACCAGGATGG + Intronic
1132667926 16:1090421-1090443 GCTGGAGCCACTCCCCAGGCAGG - Exonic
1132814918 16:1821111-1821133 GCTGCTGTCTCTCAGCACGTTGG - Intronic
1134070002 16:11255158-11255180 GCGGCTGTCGCGCACCAGGAAGG + Exonic
1134868861 16:17633470-17633492 TCTGCTGCCCTTCACCAGGCTGG + Intergenic
1137895490 16:52207417-52207439 CCTGCTCTCATTCACCATGCTGG + Intergenic
1138474971 16:57265188-57265210 CCCGCTGTCACACACCAAGCTGG + Intronic
1138815522 16:60199129-60199151 GTTGAAATCACTCACCAGGCTGG + Intergenic
1141405135 16:83785859-83785881 GTTGGAGTCACTCACCAGGACGG - Intronic
1143508542 17:7383082-7383104 GCAGGGGTCCCTCACCAGGCCGG - Exonic
1144778060 17:17794837-17794859 GCTGCTGTCCTTGACCAGGCTGG - Exonic
1146005526 17:29158418-29158440 GCTGCTGCCAAACACCATGCGGG + Intronic
1146652656 17:34616178-34616200 GCTGCTGGGAGTCAGCAGGCAGG + Intronic
1146713129 17:35060110-35060132 ACCGCTTTCACTCACCAGCCTGG + Intronic
1147197709 17:38778738-38778760 GCCACTGTCCCTCCCCAGGCCGG - Intronic
1147644386 17:42025109-42025131 CCTGCTGTCAGTCACCAGAGTGG + Exonic
1148789604 17:50166003-50166025 GTCTCTGTCACTCACCGGGCGGG + Exonic
1149654446 17:58302856-58302878 GCAGCTGTCACTGCCCAGGAAGG + Intronic
1150837337 17:68576373-68576395 GTGCCTGCCACTCACCAGGCAGG - Intronic
1152800391 17:82328134-82328156 GCTGCTCTCACTGGCAAGGCAGG + Intronic
1154109849 18:11557878-11557900 GCTGCTGTCAGTCTCCAGACAGG - Intergenic
1154193742 18:12251453-12251475 GCTGCTGGAGCTGACCAGGCCGG + Intergenic
1154273760 18:12941968-12941990 CTTGCTGTCTCCCACCAGGCTGG - Intergenic
1155252760 18:23967633-23967655 TCTGCTTTCACTTACCAGGCAGG + Intergenic
1158300168 18:56043192-56043214 GCTGCTGTAACTCACCACCAGGG - Intergenic
1158514093 18:58116773-58116795 CATGCTGGCACTCACCAGGGTGG - Intronic
1158877245 18:61745119-61745141 GCTGCTGTGACCCTCCAGGCTGG + Intergenic
1160157670 18:76445961-76445983 GCTGCTGGCACACAGCTGGCTGG - Intronic
1160207798 18:76850647-76850669 GATGGTGCCACTCTCCAGGCTGG - Intronic
1160221562 18:76981700-76981722 GCACCTGTCAGTCCCCAGGCCGG - Intronic
1160623128 18:80184662-80184684 GCTTCTGTCACTCAGCATGATGG - Intronic
1161510979 19:4670652-4670674 GCTGCAGTCAGTCACACGGCTGG - Intergenic
1161726509 19:5932437-5932459 GCTGCTGTTTCTTACCAGTCTGG + Exonic
1161787137 19:6333714-6333736 GCTGCTGTCACTGCACAGCCAGG - Intergenic
1162449286 19:10744787-10744809 ACAGCTGGCACTCACCAGGCTGG + Intronic
1162617492 19:11814164-11814186 TCTGCTGTCACTCAGCACGGAGG + Intergenic
1162648055 19:12064620-12064642 TCTGCTGTCACTCAGGATGCAGG + Intergenic
1163082318 19:14953012-14953034 GCTGCTGGCATCCCCCAGGCGGG - Exonic
1163779925 19:19240678-19240700 GCCCCTGCCACTCACCAGCCCGG - Exonic
1165151002 19:33760070-33760092 ATTGCTGTCACTATCCAGGCAGG - Intronic
1165339050 19:35197527-35197549 GGTGCTGTCTTTCCCCAGGCAGG + Intergenic
1166645144 19:44525961-44525983 GGTGATGTCACTCACCAAGATGG + Intronic
1167015155 19:46836542-46836564 TATTCTGTCACTCCCCAGGCTGG - Intergenic
1167156047 19:47739906-47739928 GCTGCTCTCACTCATCAGAGGGG + Intronic
925157245 2:1657575-1657597 GCTGCTTTCAGTCAGCAGCCAGG - Intronic
925876181 2:8312903-8312925 CCTGCTCTCCCTCAGCAGGCGGG - Intergenic
926324438 2:11772131-11772153 GATGCTGCCACTCATCTGGCAGG + Intronic
926424287 2:12727248-12727270 GATTCTGTGACTCACCGGGCAGG + Intronic
926717407 2:15935841-15935863 CCTGCTCCCACTCCCCAGGCTGG + Intergenic
929053231 2:37855521-37855543 GCTGCTTTCACTTCCCTGGCAGG - Intergenic
929642854 2:43598958-43598980 GCTGGTGGCACTGACCAGGGTGG + Intergenic
929994590 2:46817405-46817427 GCTGGGGGAACTCACCAGGCAGG + Exonic
933246864 2:79985757-79985779 GCTGCTGGCACACTCTAGGCAGG - Intronic
933773155 2:85756205-85756227 GTGGCTGTCACAGACCAGGCTGG + Intronic
934773298 2:96921564-96921586 GCTGCTGTGCCGCACCAGCCTGG - Exonic
935761411 2:106324181-106324203 GCTGCGGTGACTCAGCTGGCTGG + Intergenic
937258936 2:120573140-120573162 GCTGAGGTCAGTAACCAGGCAGG - Intergenic
937778626 2:125811164-125811186 GATGCTGTCACTCACCATCGCGG + Intergenic
937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG + Intronic
939959602 2:148554653-148554675 GCTGCTCTTTCTCCCCAGGCAGG + Intergenic
943312834 2:186348365-186348387 ACTTTTATCACTCACCAGGCAGG + Intergenic
944669357 2:201982393-201982415 GCTGCTCTCAAACACCAGTCAGG - Intergenic
945513511 2:210732361-210732383 ACTGCTGTAACTGACCAGTCTGG - Intergenic
947835502 2:233172087-233172109 ACTGCTGTCACCCACGAGGCTGG + Intronic
948049015 2:234965343-234965365 GTTTCTGAAACTCACCAGGCTGG + Intronic
948650908 2:239443124-239443146 GCTGCTGTGACCCAGGAGGCAGG - Intergenic
1169100818 20:2947030-2947052 GCTGCTTTCTCTCTCCAGCCTGG + Intronic
1169258140 20:4114434-4114456 GATGGTGTCACTCAACAGGACGG + Intergenic
1171390566 20:24799126-24799148 GCTACTGTCCCCCACCTGGCCGG + Intergenic
1172221572 20:33277737-33277759 GCGACTGTCACACACGAGGCAGG + Intronic
1172512138 20:35508123-35508145 GCTCCTGTCAATCTCCAGCCGGG - Exonic
1173626898 20:44479787-44479809 GCTGCTGTTAGTCCCCAGGGAGG - Intronic
1174131876 20:48350781-48350803 GCTGCAAACACTCACCAGCCAGG + Intergenic
1175441313 20:58994165-58994187 GATGCTGTCATTCTCCAGGATGG - Exonic
1175550107 20:59811974-59811996 GCTGCTGTCACAGTCAAGGCTGG + Intronic
1176197320 20:63843528-63843550 GATGCTGGGAATCACCAGGCGGG - Intergenic
1176582381 21:8543467-8543489 GGTGCTGTCACTGCCCAGCCAGG - Intergenic
1178408159 21:32342353-32342375 GCTGCTGCCTCCCACCAGGCTGG + Intronic
1179015678 21:37592789-37592811 CCTGCTGACACTGACCAGGCTGG + Intergenic
1179635422 21:42705621-42705643 GCTGCAGTCACACGCCAGGACGG + Intronic
1179718353 21:43301632-43301654 GCAGCTGTCACTCACTGTGCAGG - Intergenic
1179914242 21:44466344-44466366 GCTGCTGTCCCCTCCCAGGCAGG - Intergenic
1180061458 21:45387255-45387277 GCAGCTCTCACACACAAGGCAGG + Intergenic
1180111089 21:45651853-45651875 GTTTCTGTAACTCACCAGGTTGG + Intronic
1180265215 22:10520515-10520537 GGTGCTGTCACTGCCCAGCCAGG - Intergenic
1180839947 22:18954619-18954641 GCGGCCGGCACTCACCAGGCCGG + Intergenic
1181061951 22:20285860-20285882 GTGGCCGGCACTCACCAGGCCGG - Intergenic
1182681522 22:32083383-32083405 GCTGCCCTCTCTCACCAGTCTGG + Intronic
1184765183 22:46568535-46568557 CCTGCTGTGACTCTCCAGGGGGG - Intergenic
950639477 3:14339606-14339628 TCTGCTGCCCATCACCAGGCTGG - Intergenic
951099520 3:18670786-18670808 GCGGCTGTCACTTACCCAGCAGG + Intergenic
953883117 3:46701608-46701630 GAGGCTGTCACCCTCCAGGCAGG + Intronic
954194932 3:48990742-48990764 CCTGCTGTCGCTCTCCGGGCCGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954313233 3:49786339-49786361 GCTCCTGTCACTCACCTGCCCGG + Intronic
954642480 3:52109508-52109530 GCTCCTTTCAGTCACCAGGAAGG - Intronic
955303748 3:57809358-57809380 GGTGCTGTCACAGACCAGCCAGG + Intronic
958838423 3:99172846-99172868 TCTGCTGTTTCTCACCACGCAGG + Intergenic
959201323 3:103251473-103251495 GCTGCTGTCAACTTCCAGGCTGG + Intergenic
960418696 3:117416381-117416403 ACTGCTGACATTTACCAGGCAGG - Intergenic
961726400 3:128933752-128933774 CCTCCTGTCACCTACCAGGCAGG + Intronic
962084199 3:132173525-132173547 TCTGCTGCTCCTCACCAGGCAGG + Intronic
964642523 3:158925298-158925320 GGTGTTGGCACTCGCCAGGCTGG - Intergenic
965799625 3:172478324-172478346 ACTGTTTTCACTCATCAGGCTGG + Intergenic
966837476 3:184060036-184060058 GCTGGCTTCCCTCACCAGGCAGG - Exonic
967876884 3:194273542-194273564 GCTGCCGTCACTCTTGAGGCTGG + Intergenic
968598874 4:1499769-1499791 GCTGCTGTCCCAGACCAGCCAGG + Intergenic
970375750 4:15455512-15455534 GCTGCAGCCAATCCCCAGGCTGG - Intergenic
973176566 4:47213040-47213062 GCTGCTTTCACTCACCTTACAGG + Intronic
973257342 4:48126829-48126851 GCTGTTATCAGTCAGCAGGCAGG + Intronic
976219064 4:82741475-82741497 GCTGCCGTCACTCACACAGCTGG - Intronic
980487823 4:133483018-133483040 CCTTCTCTCACTCACCAGGAGGG - Intergenic
981782195 4:148442647-148442669 CAGGCTGTCAGTCACCAGGCGGG + Intronic
982879978 4:160701868-160701890 GTTTCTTTAACTCACCAGGCAGG + Intergenic
983168873 4:164513177-164513199 GCTGCTCCCACTCACCTGGCTGG - Intergenic
985524465 5:394994-395016 CCTGCTGTCGCCCCCCAGGCAGG + Intronic
985689610 5:1299804-1299826 GCTGCTTTCAGCCACCAGGCTGG - Intergenic
985953769 5:3244534-3244556 GCTGCTTCCACTCACCAGGAAGG + Intergenic
986608959 5:9547722-9547744 GCAGCTGCCACACAGCAGGCCGG - Intergenic
987409933 5:17604748-17604770 GCTGCTGTCACGGAGCAGACTGG + Intergenic
988523160 5:31964157-31964179 TCTGCTGTGACTGTCCAGGCTGG - Intronic
990943801 5:61229702-61229724 GCTGGTGTCAGCAACCAGGCAGG - Intergenic
991451845 5:66759855-66759877 GCCGCTGCGACTCACCAGTCAGG - Exonic
991454586 5:66788787-66788809 CCCGCGGACACTCACCAGGCTGG - Exonic
992102129 5:73418272-73418294 GAGCCTGTCACTCAGCAGGCTGG + Intergenic
993423549 5:87733270-87733292 GTTTCTTTCACTCACAAGGCAGG + Intergenic
996089671 5:119338470-119338492 TCTGCTATCAGTCACCAGACAGG + Intronic
996689920 5:126329421-126329443 GATGCTGTGACTGAGCAGGCAGG + Intergenic
999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG + Exonic
999413989 5:151378887-151378909 GCTGCACTCACCCAGCAGGCTGG + Intergenic
1001545159 5:172566411-172566433 GCTCCTCACACTCACCAGCCAGG - Intergenic
1001906155 5:175475165-175475187 GCTGCACTCTGTCACCAGGCTGG - Intergenic
1002987355 6:2203400-2203422 GCTGCTGACTCTCACTAGGCAGG - Intronic
1003320913 6:5050249-5050271 GCAGCTGTCACCCACCAGCCAGG + Intergenic
1004429403 6:15530227-15530249 GGTGCTGTGGCTCATCAGGCTGG + Intronic
1006256620 6:32837792-32837814 GCTGCTGAAGCTCTCCAGGCCGG - Exonic
1006459303 6:34149112-34149134 GTTGCTTTCCCTCACCAGGGAGG - Intronic
1006929350 6:37678378-37678400 GCTGCTGTCACAAGCCAGGCAGG - Intronic
1007238539 6:40408567-40408589 GCTGCTGTGAACCACCATGCTGG - Intronic
1007593163 6:43035675-43035697 GCAGCTGTCACTCAGCAGGCTGG + Intergenic
1008485510 6:52030716-52030738 GATGATGTCACTCAGCAGCCTGG + Intronic
1012530620 6:100231121-100231143 CCTGCTTTGAATCACCAGGCAGG - Intergenic
1015290613 6:131534748-131534770 GCTGCTGTCACTGCCCGGGCTGG + Intergenic
1019081207 6:169431100-169431122 GCAACTGTCACTCACCAGTTAGG + Intergenic
1019256260 7:54288-54310 CCTGCAGTAACTCACCTGGCTGG + Intergenic
1019561951 7:1663901-1663923 GCTGCTGTCCCCCCTCAGGCTGG - Intergenic
1019591535 7:1837966-1837988 GCTGCCGTGTTTCACCAGGCTGG - Intronic
1019670981 7:2278192-2278214 GCTGCTGTCCCACACCCTGCAGG - Exonic
1019789703 7:3003116-3003138 ACCGCTGTCACTCACCAATCGGG + Intronic
1020997416 7:15280977-15280999 GGTGCTGCCACACTCCAGGCTGG - Intronic
1022318460 7:29265736-29265758 TCAGCTGTCACTCACCAACCAGG - Intronic
1022339479 7:29455027-29455049 GCTGCTGACATTCAACAGCCAGG + Intronic
1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG + Intronic
1027199977 7:76057803-76057825 GCTTCTGGCACTCATCATGCTGG + Intronic
1028684254 7:93574977-93574999 GCTGCTGTCTCGCTCCAGTCAGG + Intergenic
1030371547 7:108705293-108705315 GCTACTGTCTCACACCAGTCAGG + Intergenic
1032059742 7:128714729-128714751 GATGCTGTCACTCTCCAAGAGGG + Intronic
1032298150 7:130661297-130661319 GCTGCTGTTACTCAGAGGGCTGG - Intronic
1034418013 7:150975240-150975262 GTTGCTGACACCCGCCAGGCTGG - Intronic
1034951374 7:155298673-155298695 GCTGCTGTCCCGCAGCAGGGAGG - Exonic
1035616351 8:1004912-1004934 GCTGCTGTCCGGCACCATGCAGG + Intergenic
1036390479 8:8320212-8320234 GCTGCTGTGACTCACCTTGAAGG - Intronic
1036615713 8:10385786-10385808 GATGTTGTCACTCACCTGGTGGG + Intronic
1037585239 8:20271462-20271484 GCTGGTAACACTCACCAGGAAGG - Intronic
1039124810 8:34189572-34189594 GCTACTGTCACTCACCCAGAAGG + Intergenic
1039433449 8:37543550-37543572 GCTGCAGTCCTTCACCTGGCTGG - Intergenic
1041500612 8:58534832-58534854 TGTGCTGTCACCCTCCAGGCAGG + Intergenic
1042245902 8:66708555-66708577 CATTCTGTCACCCACCAGGCTGG - Intronic
1045319400 8:101070246-101070268 GCTGCTCTCACTGGCCAGGGTGG + Intergenic
1046569520 8:115945709-115945731 GTTGTTGTCATTCAACAGGCTGG + Intergenic
1047220533 8:122915016-122915038 GCTGCTGAAAGTCACCAGGAGGG - Intronic
1047233357 8:123016742-123016764 ACTGCTGTCCCTTCCCAGGCAGG - Intronic
1050169003 9:2795973-2795995 GCTTCTGTCACTTGCTAGGCAGG - Intronic
1050819662 9:9862404-9862426 ACTACTGACACTTACCAGGCAGG - Intronic
1056250434 9:84742489-84742511 GCTGCTGCCATTCACAAGGATGG + Intronic
1056873900 9:90309403-90309425 GCTGCTGTTACTGCCCAGGCTGG + Intergenic
1057303263 9:93898634-93898656 GCTCCTGTCTGTCTCCAGGCTGG + Intergenic
1059667535 9:116462991-116463013 GCTGCTGCCATTCACCATGATGG - Intronic
1061773792 9:132946983-132947005 TCTCCTGCCACTTACCAGGCTGG + Intronic
1061849350 9:133405324-133405346 GCTGCTGTCACTCACCAGGCTGG - Exonic
1062134681 9:134918910-134918932 GCCGTTGTCTCTCAACAGGCTGG - Intergenic
1062463962 9:136673114-136673136 GCTGTGGTCACTCACAGGGCGGG - Intergenic
1203774033 EBV:62922-62944 GCTGCTGTCACTCTCCATAGCGG + Intergenic
1203612396 Un_KI270749v1:21481-21503 GGTGCTGTCACTGCCCAGCCAGG - Intergenic
1187455792 X:19440176-19440198 GCTGCTGTCACCCGCTTGGCTGG - Intronic
1188380306 X:29483719-29483741 GGCTCTGTCACTCAGCAGGCTGG + Intronic
1189246915 X:39570418-39570440 TCTGCTGGAACACACCAGGCTGG - Intergenic
1192618436 X:72652233-72652255 GCATCTGTTAGTCACCAGGCAGG + Intronic
1195244652 X:102984466-102984488 GCTGCTGACACTCAGAAGTCTGG + Intergenic
1200114437 X:153764051-153764073 GCTGCCGTCTCTCACCTGCCAGG + Intergenic
1200887068 Y:8280851-8280873 GCTGCTGTCCTCCACAAGGCAGG + Intergenic
1200894980 Y:8365924-8365946 GCTGCTGTCACTCACCATCAAGG + Intergenic