ID: 1061850115

View in Genome Browser
Species Human (GRCh38)
Location 9:133409948-133409970
Sequence CCCTCAGAGACTGCTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061850115_1061850123 25 Left 1061850115 9:133409948-133409970 CCCACGGCAGCAGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1061850123 9:133409996-133410018 CTTTCTGTGAGGACACTGCCCGG No data
1061850115_1061850127 29 Left 1061850115 9:133409948-133409970 CCCACGGCAGCAGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1061850127 9:133410000-133410022 CTGTGAGGACACTGCCCGGGGGG No data
1061850115_1061850125 27 Left 1061850115 9:133409948-133409970 CCCACGGCAGCAGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1061850125 9:133409998-133410020 TTCTGTGAGGACACTGCCCGGGG No data
1061850115_1061850124 26 Left 1061850115 9:133409948-133409970 CCCACGGCAGCAGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1061850124 9:133409997-133410019 TTTCTGTGAGGACACTGCCCGGG No data
1061850115_1061850121 14 Left 1061850115 9:133409948-133409970 CCCACGGCAGCAGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1061850121 9:133409985-133410007 ACACAGAAGACCTTTCTGTGAGG No data
1061850115_1061850126 28 Left 1061850115 9:133409948-133409970 CCCACGGCAGCAGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1061850126 9:133409999-133410021 TCTGTGAGGACACTGCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061850115 Original CRISPR CCCTCAGAGACTGCTGCCGT GGG (reversed) Intronic
900165702 1:1243539-1243561 CCCTCACAGCCTGCTGCCCAAGG - Exonic
900933662 1:5752105-5752127 CCCTCAGCCCCTGCTGCCCTGGG - Intergenic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
902751271 1:18513071-18513093 CCCCAGGAGACTGTTGCCGTCGG + Intergenic
904365188 1:30006297-30006319 CACTCAGAGGCTGCTGTCCTGGG - Intergenic
904422788 1:30404954-30404976 CCCTCAGAGCCTGCTGCTCTGGG + Intergenic
907549131 1:55289251-55289273 CCCTAACAGACTGCTTCCATGGG + Intergenic
907585700 1:55615961-55615983 CCCACAGAGACTGCTGTAGTGGG + Intergenic
908648994 1:66311628-66311650 ACTTCAGAGACTGCTGCTGCTGG - Intronic
913167928 1:116206103-116206125 GCCCCAGAGGCTGCTGCCATTGG + Intergenic
914244020 1:145872660-145872682 CCCTCGGAGACCGCTGCTCTGGG + Exonic
914684442 1:149965822-149965844 CTCTCAGAGGCTGCTTCCTTTGG - Exonic
916016713 1:160756233-160756255 CCCTCAGAGAGGGCTGCTGGAGG + Intergenic
920987391 1:210903280-210903302 CCCTCTTAGACTGCTGCCTCTGG + Intronic
1063964360 10:11335216-11335238 CCCTCAAAGACTGAAGCCGCAGG + Exonic
1067749132 10:48958360-48958382 CCCTGAGTGACTCCTGCTGTGGG - Intronic
1068888934 10:62128092-62128114 CCCTGAGAGGCTCCTGCAGTAGG - Intergenic
1070392774 10:75985630-75985652 CTCTCACAGACTGCTGAGGTTGG - Intronic
1070824331 10:79381993-79382015 GCCTCAGAGACGGCAGCCCTGGG - Intergenic
1071956904 10:90770250-90770272 CTCTGAGAGCCTGCTGCCCTGGG + Intronic
1072675874 10:97465642-97465664 TCCTCAGAGACTGATTCAGTTGG + Intronic
1073185709 10:101613987-101614009 CCCTTAGAGACTGCTAACCTTGG + Intronic
1074117024 10:110464047-110464069 CCCTCAGAGTCAGCTGGCGGTGG - Intergenic
1075114734 10:119616708-119616730 CCCTCAGGTACTGCTGCCTCTGG + Intergenic
1076186803 10:128456727-128456749 CCCTCAGGGGCTGCTGATGTGGG - Intergenic
1076329216 10:129652624-129652646 CCCGCAGTGGCTGCTGCTGTTGG + Intronic
1076496193 10:130899261-130899283 CCCCCAGAGACTGCTGTAGTGGG - Intergenic
1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG + Intronic
1077324305 11:1957120-1957142 TCCTGAGACACTGCTGCCCTCGG - Intronic
1079078842 11:17399949-17399971 CCCTCAGACCTTGCTGACGTAGG + Intronic
1079093278 11:17495242-17495264 CCCTCAGAGAATGTTGCCCAGGG + Intronic
1080197983 11:29633985-29634007 GCCCCAGAGTCTGGTGCCGTAGG + Intergenic
1083394714 11:62382267-62382289 AACTCAGAGACTGTTGCCGGTGG - Intronic
1083635432 11:64118189-64118211 CTTGCAGAGGCTGCTGCCGTTGG - Exonic
1084493201 11:69489340-69489362 ACACCAGAGGCTGCTGCCGTTGG + Intergenic
1088590624 11:111399691-111399713 CTCTCAGAGACTGCTGTCCCGGG - Intronic
1202807291 11_KI270721v1_random:12315-12337 TCCTGAGACACTGCTGCCCTCGG - Intergenic
1096491385 12:52014945-52014967 CCCGCCGAGACCCCTGCCGTGGG + Exonic
1096657519 12:53100909-53100931 CCATCTGAGACTGCTCCCTTGGG + Intronic
1098842460 12:75493059-75493081 ACCACAGAGACTGGTGCCCTCGG + Exonic
1102452427 12:113051991-113052013 CCCTCAGAAACTGATGTAGTTGG - Intergenic
1103823997 12:123721468-123721490 CCCACAGTGACAGCTGCCATGGG - Intronic
1104307870 12:127626117-127626139 CCCTCAGAGGATGCTGGTGTAGG - Intergenic
1104429003 12:128701358-128701380 CCCTCAGAGCCAGCTGGTGTTGG + Intronic
1104465633 12:128987999-128988021 CCCTGAGAGTCTGATGCCTTTGG - Intergenic
1104641808 12:130471885-130471907 CCCTCAGCGACTGGTGACCTGGG + Intronic
1109183956 13:59247332-59247354 CTCTCCTAGACTGCTGCTGTGGG + Intergenic
1110604131 13:77411224-77411246 CACTGACAGACTGCTGCCTTGGG - Intergenic
1115972346 14:38959820-38959842 CTCTCAGAGACAGCTTCTGTTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118473270 14:66094311-66094333 CCCTCAGAGCCCACTGCCCTGGG - Intergenic
1121775841 14:96590264-96590286 TCCTCAGAGCCTGCGGCCTTGGG - Intergenic
1121923346 14:97904125-97904147 CTCTCAGCCACTCCTGCCGTTGG - Intergenic
1123143433 14:106105522-106105544 CCCATAGAGACTGCAGCCATGGG + Intergenic
1124336759 15:28862956-28862978 CTCTCAGAGTCTGCTGTCGAAGG - Intergenic
1125171757 15:36773206-36773228 CCCTCAGAGACAAGTGCCATTGG - Intronic
1127311421 15:57754990-57755012 CATTCAGGGACTGATGCCGTAGG + Intronic
1128392589 15:67192596-67192618 CCCTCGGAAACTGCTGCCCATGG - Exonic
1129164978 15:73771758-73771780 CCCTCAAAAGCTGCTGCCATTGG + Intergenic
1130893265 15:88151033-88151055 CCCACAGAAAAGGCTGCCGTGGG - Intronic
1131724825 15:95209880-95209902 CTCTCAAAGACTGCTGTCCTTGG - Intergenic
1131841435 15:96441755-96441777 GCCTCAGAGGCTGTTGCCATGGG + Intergenic
1132495232 16:260011-260033 CTCCCAGAGCGTGCTGCCGTTGG - Exonic
1132903542 16:2271001-2271023 CCCTCAGAGGCTGGTGGCCTGGG + Intergenic
1133914535 16:10097154-10097176 AGCTCAGAGACTGCTGCCTAAGG - Intronic
1135921798 16:26657186-26657208 TCCTCAGACACTGCTTCTGTAGG + Intergenic
1136155538 16:28379806-28379828 CCGTCTGAGACTGCTGCTGGCGG + Exonic
1136207546 16:28735483-28735505 CCGTCTGAGACTGCTGCTGGCGG - Exonic
1140479191 16:75253379-75253401 CCTGCAGAGACTGCTGCCTGGGG - Intronic
1141087984 16:81110408-81110430 CCCTCTGACACTGCAGCCCTGGG - Intergenic
1142126831 16:88414583-88414605 CCCTCGGACCCTCCTGCCGTGGG - Intergenic
1144948163 17:18980381-18980403 CCCTCAGAGACTGTGGCCAAGGG + Intronic
1145392194 17:22464201-22464223 CCCTCTGAGACTGTTTCCCTAGG - Intergenic
1146143511 17:30389135-30389157 CCCCCAGAGCCCGCTGCCCTGGG - Intronic
1151111497 17:71683179-71683201 CCCTTTGAGACTGCTGCTCTAGG - Intergenic
1152312049 17:79557455-79557477 ATCTCAGAGACTGCAGCTGTGGG - Intergenic
1152557167 17:81059137-81059159 CCCCCACAGGCTGCTGCCTTGGG + Intronic
1153995247 18:10434598-10434620 CCCCCAGGGGCTGCTGCTGTTGG - Intergenic
1154269572 18:12907397-12907419 CATTCAGCGACTGCTGCGGTTGG - Intronic
1157084068 18:44559592-44559614 CCTTAAGAGTCTGCTGCTGTTGG - Intergenic
1161175962 19:2842100-2842122 CCCCCAGAGACCGCGGCCGGAGG - Intronic
1162475348 19:10896329-10896351 CCCCCAGATTCTGCTGCCCTGGG + Intronic
1162960286 19:14121662-14121684 ATCCCAGAGACTGATGCCGTGGG - Exonic
1163633961 19:18429942-18429964 CCCTCAGGGACTGCTGCAAGGGG - Intronic
1168192772 19:54751854-54751876 CCCTCTGTGGCTGCTGCCTTGGG - Intronic
926744978 2:16149250-16149272 ACCTCATTGACTGCTGCTGTGGG - Intergenic
927364850 2:22282928-22282950 CCTGCTGAGATTGCTGCCGTTGG + Intergenic
927709135 2:25314334-25314356 CTCTCAGAGGCTGCTGGGGTAGG - Intronic
929576834 2:43057355-43057377 CCCTCAGCCTCTGCTGCCTTTGG - Intergenic
932634625 2:73377650-73377672 TCCTCAGAGACTCCTTCCCTGGG + Intergenic
936278583 2:111120247-111120269 CCCTAAGAGACAGAGGCCGTGGG - Intronic
937403707 2:121608446-121608468 CCCTCTTAGAATGCTGCCCTGGG + Intronic
937599335 2:123711241-123711263 ACCTCTGAGACTGCTGCTATGGG + Intergenic
938368710 2:130755840-130755862 CCTTCCGAGAGTGCTGCGGTCGG + Intronic
938662775 2:133504706-133504728 TCCTCAGAGGCTGCTGACTTGGG - Intronic
938938784 2:136150293-136150315 ACCTCAGAGACTGCTTCCTAAGG + Intergenic
941861372 2:170284369-170284391 CCATGAGAGACTGCTGCTTTTGG - Intronic
945061071 2:205909376-205909398 CCCTCAGTGCCTGCTGTCTTGGG + Intergenic
946217225 2:218193901-218193923 CCCAGAGAGAGTGCTGCAGTGGG - Intergenic
946756605 2:222953768-222953790 CCCCCAGAGCCTCCTGCTGTGGG + Intergenic
947019559 2:225659925-225659947 CCTTCAGTGACTACTGCCTTTGG - Intergenic
948284015 2:236769991-236770013 CCCTGAGAGAATGCAGCCTTTGG - Intergenic
1169468099 20:5859168-5859190 CCCTAAGAGACTTTTGCTGTTGG - Intronic
1170740678 20:19053404-19053426 CTCAGAGAGACTGCTCCCGTGGG + Intergenic
1171037239 20:21724984-21725006 CCCTCTTAGACTGCTGCCCTGGG - Intergenic
1171280212 20:23889943-23889965 CCTTCAGAGACTGCTCCCCAGGG - Intergenic
1171423709 20:25035959-25035981 CACTCAGTGACTGGTGCCTTGGG + Intronic
1175074702 20:56362830-56362852 CTCGCAGAGACAGCTGCAGTCGG + Intronic
1178609371 21:34067450-34067472 GCACCAGAGACTGCTGCGGTGGG - Intergenic
1179611891 21:42557278-42557300 GCCCCAGGGACTGCTTCCGTGGG + Intronic
1181469893 22:23131824-23131846 CCCCCAGAGACTGCTCCTGGTGG + Intronic
1181570487 22:23765595-23765617 CCCTCAGAGTCAGATGCCCTTGG + Intronic
1181776849 22:25166107-25166129 CCCTCGGAAGCTGCCGCCGTGGG + Intronic
1184908767 22:47511486-47511508 CTCTCAGAGACACCTGCCCTGGG - Intergenic
1185033892 22:48460814-48460836 CCCCGAGAGACTCCTGCTGTGGG + Intergenic
949465506 3:4339317-4339339 CTCCCAGAGACTGCTTCCTTGGG - Intronic
950479464 3:13235554-13235576 CCCTCTGAGACTGCTGGAGGTGG + Intergenic
950534461 3:13571115-13571137 CCCACAGCGGCTGCTGCCCTGGG + Exonic
950776137 3:15352046-15352068 ACCTCTGAGACTGCTCTCGTGGG - Intergenic
951795941 3:26538419-26538441 CTCCCAAAGACTGCTGCCCTTGG + Intergenic
961433119 3:126897184-126897206 CCCACAGACACTGCTGCAGCAGG + Intronic
966714344 3:183000608-183000630 CCATAAGAGACTTCTGCCCTAGG - Intergenic
968975814 4:3821574-3821596 CCCTCAGAGGCTGCGGACGGTGG + Intergenic
975526200 4:75353078-75353100 CCCAGAGAGACTGCTGCTGAGGG + Intergenic
977669688 4:99681889-99681911 ACCTCAGAGCCTGTTGCCATCGG + Intergenic
984282303 4:177685842-177685864 CCCTAAGAGCCTGCTGACATGGG + Intergenic
985666433 5:1183752-1183774 CCCTCAGGGGCTGCTGCAGGGGG + Intergenic
985685678 5:1280444-1280466 CCTTCAGCGTGTGCTGCCGTGGG - Intronic
985777785 5:1853928-1853950 CCCTCAGTGCCTGCTGCTGAGGG - Intergenic
993397509 5:87408608-87408630 CCCTTAGAGACTTCTGCCGATGG - Intronic
994589733 5:101758653-101758675 CTGTCAGAGACTGCTGCCCAAGG - Intergenic
1001695218 5:173664801-173664823 CCCTCAGAGGCCACTGCCGTGGG + Intergenic
1003314678 6:5001732-5001754 CCCTCTGAGACAGCTGCTGTGGG + Intronic
1004187865 6:13436974-13436996 GCCTCTGAGGCTGATGCCGTTGG - Intronic
1012986474 6:105881505-105881527 CCATCACTGACTGCTGCCCTGGG + Intergenic
1013416964 6:109934008-109934030 CCCTCATGGAGTGCTGCCGGAGG + Intergenic
1017820621 6:158046574-158046596 CCCTCCTTGACAGCTGCCGTTGG + Intronic
1024250518 7:47502566-47502588 CCCTCATCGCCTGCTGCCCTGGG - Intronic
1025197659 7:56945133-56945155 GGCTCAGAGACTGCTGCCCCAGG + Intergenic
1025674287 7:63631805-63631827 GGCTCAGAGACTGCTGCCCCAGG - Intergenic
1028406981 7:90485894-90485916 CCCACAGAGACTTCTGGCCTTGG - Intronic
1029713757 7:102314529-102314551 CCCCCAGAGACGACAGCCGTGGG + Exonic
1034210569 7:149358878-149358900 CCCCCGGAGCCTGCTGCCCTGGG - Intergenic
1034887272 7:154807288-154807310 CCCACAGAGCCTGGTGCAGTGGG + Intronic
1036682940 8:10888963-10888985 CCATCAGAGAATGCTCCTGTGGG - Intergenic
1038168928 8:25111020-25111042 CCCGCAGCCACTGCTGCAGTGGG + Intergenic
1039153820 8:34533126-34533148 CCCTCAGAAACTTGTGCAGTTGG + Intergenic
1039725750 8:40214460-40214482 CCATCAGGGCCTGCTGCCCTGGG + Intergenic
1043116035 8:76255039-76255061 CCTACAGACACTGCTGCTGTGGG + Intergenic
1049192410 8:141295663-141295685 GCCTCAGTCAGTGCTGCCGTGGG - Intronic
1050012702 9:1201183-1201205 CTCCCAGAGTCTGCTGCCTTGGG - Intergenic
1051201693 9:14633633-14633655 CCCACAGCCACTGCTGCAGTTGG + Intronic
1052671039 9:31557644-31557666 CCCTCAGACACTGGTACCCTTGG + Intergenic
1057242490 9:93423637-93423659 CCCCCAGCCACTGCTGCCCTTGG - Intergenic
1060771288 9:126334008-126334030 CCCTGAGATACTGATGCAGTAGG - Intronic
1061850115 9:133409948-133409970 CCCTCAGAGACTGCTGCCGTGGG - Intronic
1061917254 9:133761768-133761790 CTCTCAGACCCTGCTGCGGTTGG + Intergenic
1062513056 9:136918071-136918093 TTCTCAGAGAGTGCTGCTGTTGG - Intronic
1185728913 X:2445537-2445559 CCCCAAGGGACCGCTGCCGTGGG + Intronic
1186543676 X:10426506-10426528 CCCTCAGGGCCTTCTGCCATTGG + Intergenic
1194127765 X:90041015-90041037 CCCGCAGAGCCAGCTGCTGTTGG - Intergenic
1194977307 X:100408636-100408658 CCCTCCGAGACCGACGCCGTCGG + Exonic
1195626058 X:107006582-107006604 CTCTCAGAGCCTGCTTCCCTGGG - Intergenic
1196908664 X:120464460-120464482 CTCTTAGAGACTGCTACCATAGG + Intronic
1198040138 X:132842694-132842716 CCTTCAGAGGCTGCTTCTGTCGG - Intronic
1199912808 X:152306209-152306231 CTCTCACACACTGCTGCAGTTGG + Intronic