ID: 1061852437

View in Genome Browser
Species Human (GRCh38)
Location 9:133424017-133424039
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061852433_1061852437 0 Left 1061852433 9:133423994-133424016 CCATGATGTTACTTGTGAAACAC 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG No data
1061852432_1061852437 11 Left 1061852432 9:133423983-133424005 CCTGTCGGGGTCCATGATGTTAC 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG No data
1061852428_1061852437 28 Left 1061852428 9:133423966-133423988 CCACTCGTGTTCAGTTTCCTGTC 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr