ID: 1061853182

View in Genome Browser
Species Human (GRCh38)
Location 9:133428072-133428094
Sequence CTGGCCTCTCCCACCCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061853175_1061853182 -1 Left 1061853175 9:133428050-133428072 CCACCTCCTACCTCACCGGTGCC 0: 1
1: 1
2: 4
3: 26
4: 319
Right 1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG No data
1061853171_1061853182 24 Left 1061853171 9:133428025-133428047 CCAAGCGGGGCCTCCAGAGTGGA 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG No data
1061853173_1061853182 11 Left 1061853173 9:133428038-133428060 CCAGAGTGGAGTCCACCTCCTAC 0: 1
1: 0
2: 4
3: 10
4: 115
Right 1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG No data
1061853178_1061853182 -7 Left 1061853178 9:133428056-133428078 CCTACCTCACCGGTGCCTGGCCT 0: 1
1: 0
2: 0
3: 9
4: 191
Right 1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG No data
1061853176_1061853182 -4 Left 1061853176 9:133428053-133428075 CCTCCTACCTCACCGGTGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 199
Right 1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG No data
1061853172_1061853182 14 Left 1061853172 9:133428035-133428057 CCTCCAGAGTGGAGTCCACCTCC 0: 1
1: 1
2: 0
3: 13
4: 210
Right 1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061853182 Original CRISPR CTGGCCTCTCCCACCCCATT AGG Intronic
No off target data available for this crispr