ID: 1061853632

View in Genome Browser
Species Human (GRCh38)
Location 9:133429701-133429723
Sequence GGGAGCGGCGACGGAGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061853632_1061853641 4 Left 1061853632 9:133429701-133429723 CCCGTCCCTCCGTCGCCGCTCCC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1061853641 9:133429728-133429750 CTGGCCACCCACCTCTGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 218
1061853632_1061853647 22 Left 1061853632 9:133429701-133429723 CCCGTCCCTCCGTCGCCGCTCCC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1061853647 9:133429746-133429768 GCCGGCAGGAGCCTTAGTCTTGG 0: 1
1: 0
2: 2
3: 6
4: 81
1061853632_1061853643 8 Left 1061853632 9:133429701-133429723 CCCGTCCCTCCGTCGCCGCTCCC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1061853643 9:133429732-133429754 CCACCCACCTCTGCGCCGGCAGG 0: 1
1: 0
2: 2
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061853632 Original CRISPR GGGAGCGGCGACGGAGGGAC GGG (reversed) Intronic
900119382 1:1041993-1042015 GGGGACGGCCACGGCGGGACAGG - Exonic
900342156 1:2194459-2194481 GGGAGAGGCGCGGGAGGGCCTGG + Intronic
900803501 1:4752198-4752220 GGGAGAGGAGGAGGAGGGACAGG + Intronic
900852961 1:5158155-5158177 GGGAGTGGTGACGGAGGTAGAGG - Intergenic
901756501 1:11444584-11444606 GGGAGCGGGGGCCGAGGGACTGG - Intergenic
902078670 1:13806292-13806314 GGGAGCGGAGACGGAGCGAGGGG - Intronic
903203627 1:21763847-21763869 GGGAGGGAGGACGGATGGACAGG + Intronic
903324832 1:22563730-22563752 GTGAGCGGCGGCGGCGGGGCGGG + Intronic
904751077 1:32741797-32741819 GGGAGCGGCGCGGGAGGGGCCGG - Intergenic
905546570 1:38804559-38804581 GTGGGGGGCGACGGAGGGGCGGG + Intergenic
905779067 1:40691907-40691929 GGAAGCGGCGGCGGGGGGAGGGG + Intronic
905912040 1:41662020-41662042 GGGAGCCGCGTCGGTGGGAGAGG - Intronic
906653817 1:47533585-47533607 GGGGGCGGCGCCGGAGGATCGGG + Intergenic
910449031 1:87328651-87328673 GGGAGCGGCGGCGGACGGTGCGG - Exonic
912595265 1:110869569-110869591 TGGAGCGGGGAAGGAGGGAGAGG + Intergenic
913314069 1:117535259-117535281 GGGAGAGGCGAGGGAGAGAGGGG - Intergenic
914992608 1:152511759-152511781 GAGGTCGGCGTCGGAGGGACTGG - Exonic
915943735 1:160135329-160135351 GGGACCGGGGAGGCAGGGACAGG + Intronic
916090530 1:161305301-161305323 GGTAGAGGGGAGGGAGGGACGGG + Exonic
917929891 1:179815806-179815828 GGGAGCGGGGAGGGAGGAAGAGG + Exonic
918999699 1:191814361-191814383 GGGACCCCCAACGGAGGGACCGG - Intergenic
919712134 1:200739108-200739130 GGCAGCGGCGACGGCGGCAGGGG + Intergenic
920200569 1:204257517-204257539 GGGAGCGGGGCTGCAGGGACAGG + Exonic
920540796 1:206776573-206776595 GAGAGCGGGGACTGAGAGACAGG + Intergenic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
923037066 1:230291891-230291913 GGGAGCGGTGAAGGAGGGAGCGG + Intergenic
1063536756 10:6891214-6891236 AGGAGGGGCCAGGGAGGGACGGG - Intergenic
1063962107 10:11315183-11315205 GGGATCTGAAACGGAGGGACAGG - Intronic
1066022865 10:31319893-31319915 GGCTGCGGCGGCGGCGGGACGGG + Intronic
1067280628 10:44869417-44869439 GGGAGGGGAGACGGAGAGGCAGG + Intergenic
1067543108 10:47171022-47171044 GGGAGCCTGAACGGAGGGACTGG - Intergenic
1072610504 10:97014421-97014443 GGGAGCGGGCACAGAGGGGCAGG + Intronic
1072750482 10:97975087-97975109 GGGAGGAGCGGCGGAGGGGCCGG + Intronic
1072937977 10:99731908-99731930 GGGAGCGGGGATGGAGTGAAAGG - Intronic
1073146275 10:101284104-101284126 GGGAGCGGGGAGCGAGGGGCGGG + Intergenic
1073433145 10:103499858-103499880 GGCAGCATCGAAGGAGGGACCGG - Intronic
1074182550 10:111077198-111077220 AGGAGCCGCGACGGAGGCAGGGG - Exonic
1074584110 10:114749909-114749931 GGGATCGGGGATGGAGGGTCTGG - Intergenic
1075970738 10:126650004-126650026 GGGAGGGGAGAGGGAGGGAAAGG + Intronic
1076704277 10:132292881-132292903 GGGAGGGACCAGGGAGGGACCGG - Intronic
1076705138 10:132297306-132297328 GGCAGCGGGGGCGGAGGCACCGG - Intronic
1076734501 10:132452653-132452675 TGGAGCTGGGAGGGAGGGACTGG + Intergenic
1076853183 10:133103035-133103057 GGGAGGGGCGCCGGAGGGGAGGG + Intronic
1077023615 11:430436-430458 GGGGGCGGTGGGGGAGGGACAGG + Intronic
1077112187 11:866733-866755 GGGAGGAGGGAGGGAGGGACAGG + Exonic
1078091806 11:8268625-8268647 GGGAGCGCAGGAGGAGGGACTGG + Intronic
1078126828 11:8574074-8574096 GAGAGGGGCCACTGAGGGACTGG - Intronic
1078210328 11:9265155-9265177 GGTAGCGGCGGCGGCGGGAGGGG - Exonic
1079076814 11:17389411-17389433 GGGAGGGGCGCGGGAGGGGCGGG - Intergenic
1079613187 11:22458206-22458228 GGGAGGGGAGAGGGAGGGAAAGG - Intergenic
1079995763 11:27293583-27293605 GGGAGGGGAGGCGGAGGGAGAGG + Intergenic
1080551387 11:33376354-33376376 TGGGGCGGCGAGGGTGGGACGGG - Intergenic
1083320798 11:61845290-61845312 CGGAGCTGCGAGGGAGGGTCTGG - Intronic
1083439173 11:62664908-62664930 GGGAGCGGCGTCTGAGGCACCGG - Exonic
1083922481 11:65788064-65788086 GTGAGCCGAGACGGTGGGACAGG + Intronic
1087407349 11:97745977-97745999 GGGAGAGGCAACGGTGGAACTGG - Intergenic
1087829921 11:102808281-102808303 GGCAGCGTCGGCAGAGGGACAGG - Intergenic
1089868943 11:121655677-121655699 GGGAGGGGCGCGAGAGGGACGGG - Intergenic
1090484817 11:127103804-127103826 GCGAGTGGGGATGGAGGGACAGG - Intergenic
1091037104 11:132244195-132244217 GGGATGGGTGACTGAGGGACTGG - Intronic
1092239491 12:6828384-6828406 GGGAGCCGAGAGGGAGGGAGAGG - Intronic
1092502644 12:9064519-9064541 GAGAGCGGCGACATAGGGCCAGG - Intergenic
1094585529 12:31774132-31774154 GGGAGGGGCGAATGAGGAACAGG + Intergenic
1096473070 12:51890893-51890915 GGCAGTGGTGACGAAGGGACTGG - Exonic
1096513854 12:52145877-52145899 GGGAGCTGACACAGAGGGACAGG - Intergenic
1096718668 12:53505735-53505757 GGGAGCAACTGCGGAGGGACAGG - Exonic
1096733350 12:53632348-53632370 GGAAGCGGGGAGGGAGGGAAAGG + Intergenic
1097223092 12:57461759-57461781 GGGGGCGGGGAAGGCGGGACCGG + Intronic
1097602221 12:61706875-61706897 GGGAGGGGGGAGGGAGGGAGGGG + Intergenic
1101548412 12:105738772-105738794 GGGTCCGGCGAAGGAGGGACAGG + Intergenic
1102506543 12:113387864-113387886 GGGAGCGCTGACGCAGGGCCTGG - Exonic
1103348164 12:120265114-120265136 GGGGGCGGCCCTGGAGGGACGGG + Intronic
1104663968 12:130634228-130634250 GGGAGCGGAGACGGGGAGGCGGG + Intronic
1110436542 13:75482416-75482438 GGAAGGAGCGAGGGAGGGACGGG - Intergenic
1110732192 13:78891409-78891431 GGGTGGGGAGAAGGAGGGACAGG + Intergenic
1112746501 13:102533096-102533118 GGGACCACCAACGGAGGGACCGG + Intergenic
1113542009 13:111115893-111115915 GGGAGCGGGGTCGGGGGGAGGGG + Intronic
1113653915 13:112056442-112056464 GGGAGCGGCGAGAGGAGGACGGG + Intergenic
1114318320 14:21526270-21526292 GGGAGCAGCGGCGGAGGGGGAGG + Intronic
1114394513 14:22344886-22344908 GGGACCCCAGACGGAGGGACCGG - Intergenic
1114484991 14:23057027-23057049 GGGAGAGGAGAGGGAGGGAAAGG + Intronic
1114633022 14:24171796-24171818 GGGAGCGGCGGGGGAGCGACGGG + Intergenic
1116426599 14:44798918-44798940 GGGAGCGGGGAGGCGGGGACGGG - Intergenic
1116470592 14:45281474-45281496 GGGACCCCGGACGGAGGGACAGG + Intergenic
1117672886 14:58125807-58125829 GAGAGCGGGGACTGAGAGACAGG + Intronic
1117910699 14:60636044-60636066 GGGAGCGGGGAGAGAGGAACAGG - Intergenic
1120168007 14:81220829-81220851 GGCAGCGGCGGCGCAGGGAGCGG - Exonic
1120190666 14:81436560-81436582 GGGAGCCGGGGCGGGGGGACTGG + Intergenic
1121309691 14:92929114-92929136 GGCAGCGGCGGCGGGGGGAGAGG + Intronic
1121735868 14:96217731-96217753 GGGAGCCCCGAGGCAGGGACAGG + Intronic
1122084402 14:99289824-99289846 GGGAGAGGCGGGGGAGGCACAGG + Intergenic
1122140471 14:99660170-99660192 TGGGGCGGCCACGGAGGGAGGGG - Intronic
1122274879 14:100586392-100586414 GGGAGCGGGGCCGGATGGATAGG - Intronic
1123083453 14:105706712-105706734 AGGAGCGGCGAGGGAGTGAGGGG - Intergenic
1123490514 15:20776082-20776104 TGGGGCGGCGGCGGCGGGACCGG + Intergenic
1123547015 15:21345169-21345191 TGGGGCGGCGGCGGCGGGACCGG + Intergenic
1124014283 15:25862935-25862957 GCGAGCGGCGACGGCGGCGCGGG - Exonic
1124696378 15:31867897-31867919 GGGAGCGGAGGGGGAGGGGCGGG + Intronic
1128454950 15:67827104-67827126 GGGAGCGGCGGCGGCGGCGCGGG + Intronic
1128737705 15:70062657-70062679 GGGAGGGGGGATGGGGGGACGGG - Intronic
1130115529 15:81001850-81001872 CGGAGCGGGGAGGGCGGGACGGG - Exonic
1130540345 15:84817356-84817378 GGGAGCGGCGGCGGCGGGCAGGG + Exonic
1131056702 15:89379177-89379199 GGCAGCCGCGACGGAGGGTCCGG - Intergenic
1202955347 15_KI270727v1_random:72385-72407 TGGGGCGGCGGCGGCGGGACCGG + Intergenic
1132531207 16:450822-450844 GGGGGCGGGGAGGGAGGGAGCGG - Intronic
1132670645 16:1100936-1100958 GGGAGCGGAGCCGGATGGCCAGG + Intergenic
1132703035 16:1230033-1230055 TGGAGCTGGGACGGGGGGACCGG + Intronic
1132705288 16:1240835-1240857 TGGAGCTGGGACGGGGGGACCGG - Intronic
1132708416 16:1256198-1256220 TGGAGCTGGGACGGGGGGACCGG - Exonic
1133207195 16:4240756-4240778 AGGAGCGGCCACGAAGGGAGAGG + Intronic
1133311136 16:4847538-4847560 GGCGGCGGCGACGGTGCGACCGG + Intronic
1134644901 16:15858185-15858207 AGGAGCGGGGAGGGAGGGACGGG - Intergenic
1135186112 16:20317084-20317106 GGGAGGGGAAAGGGAGGGACAGG - Intronic
1135927689 16:26709834-26709856 GGGAGGGGGGAGGGAGGGAGGGG + Intergenic
1136913639 16:34162583-34162605 GGGGGAGGCGAGGGAGGGGCGGG - Intergenic
1137386478 16:48047408-48047430 GGGAGTGGAGAGGGAGGGAATGG + Intergenic
1137617315 16:49855663-49855685 GGGAGCGAGGGAGGAGGGACCGG - Intronic
1139325730 16:66151458-66151480 GGGAGCGGTGAGAGAAGGACAGG + Intergenic
1140419280 16:74804917-74804939 GGGAGGGGGAAGGGAGGGACAGG - Intergenic
1140512288 16:75517075-75517097 GGGACCGGCGAGGAAGTGACGGG + Intergenic
1140753339 16:78045960-78045982 GGGCGCGGAGACGAAGGGGCCGG + Intronic
1140814012 16:78604671-78604693 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814020 16:78604686-78604708 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814028 16:78604701-78604723 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814036 16:78604716-78604738 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814044 16:78604731-78604753 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814052 16:78604746-78604768 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814060 16:78604761-78604783 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1140814068 16:78604776-78604798 GGGAGGGGGGAAGGAGGGAGGGG - Intronic
1142434582 16:90048023-90048045 GGGCGGGGGGACGGCGGGACGGG + Intergenic
1143642970 17:8210148-8210170 GGGCGCAGGGACGGAGGGAAGGG + Intronic
1143830302 17:9645680-9645702 GGGAGCGGCGGCGGCGGGGCCGG - Exonic
1144278785 17:13703316-13703338 GGGAGGGGGGACTGAGGGAGCGG + Intergenic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1147123773 17:38352152-38352174 GGGGGCGGTGGCGGAGGGCCTGG - Intergenic
1147187247 17:38719636-38719658 GGGAGGAGGGACGGAGAGACCGG + Intronic
1147612959 17:41812294-41812316 GGGCGCAGCGACGGAAGGCCCGG - Intronic
1148054823 17:44787695-44787717 GGGAGCGGCGGCAGTGGGAGCGG - Intergenic
1148126964 17:45242059-45242081 GGCGGCGGCGGCGGAGGCACCGG - Exonic
1148684985 17:49496047-49496069 GGGAGGGGCGTCGGAGGGAGAGG + Intronic
1150929842 17:69572989-69573011 GGGAGGGGAGACGAAGGGAGGGG - Intergenic
1151606767 17:75142568-75142590 GGGAGGGGAGAGGGAGGGAGAGG + Intronic
1151662665 17:75526762-75526784 GGGAGCGGGCAGGGAGGGAATGG + Intronic
1152408453 17:80110374-80110396 GGGAGCAGCTAGGGAGGGTCTGG + Intergenic
1152518006 17:80837351-80837373 GGGGGAGGCAAGGGAGGGACAGG + Intronic
1152566013 17:81100781-81100803 TGGAGCAGTGAGGGAGGGACTGG - Intronic
1152614426 17:81331293-81331315 AGGAGCGGGGACCCAGGGACAGG - Intergenic
1152637477 17:81436077-81436099 GGGAGCAGAGAGGGAGGGGCTGG - Intronic
1152870359 17:82750808-82750830 GGGACGGGGGACGGGGGGACAGG - Exonic
1152870384 17:82750865-82750887 GGGGATGGAGACGGAGGGACGGG - Exonic
1155474800 18:26226950-26226972 GGGAGCGGCGCCGGCGGGTTCGG - Exonic
1155966068 18:32036621-32036643 GGGAGAGGGGAGGGAGGGAGGGG + Intronic
1156609844 18:38713098-38713120 GGGAGAGGCAACAGAGGGACGGG + Intergenic
1157604645 18:48918264-48918286 GGTAGCGGCGGAGGAGGGGCAGG - Intergenic
1157867144 18:51197080-51197102 GGCAGCGGCGGCGCAGGGCCAGG - Exonic
1159343622 18:67169410-67169432 GGGAGGGGAGAGGGAGGGAGAGG + Intergenic
1160437437 18:78862401-78862423 GGGAGAGGCGACACAGGGAGAGG + Intergenic
1160453038 18:78978801-78978823 GGGCGCGGCGACGACGGGGCCGG + Intergenic
1160719077 19:589801-589823 GGGAGGGGCGGGGGAGGGGCGGG - Intergenic
1161010772 19:1958528-1958550 GGACGGGGGGACGGAGGGACAGG - Intronic
1161179180 19:2867820-2867842 GGGAGGGGCGAGGGGTGGACAGG + Intronic
1161266587 19:3367182-3367204 GGGAAAGGCGACCGAGGGCCAGG - Intronic
1161327527 19:3670820-3670842 GGGGACGGGGACGGAGGGAGTGG + Intronic
1161382211 19:3971338-3971360 GGGCGGGGCGATGAAGGGACCGG - Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162310089 19:9901030-9901052 GGAAGCGGGGAGGGAGGGAAGGG + Intronic
1162929877 19:13952552-13952574 GGGAGCGGCGGCGGCGGCCCCGG + Exonic
1163144955 19:15373804-15373826 GGGAGCGGCGGCGGTGGGGAGGG - Exonic
1163806995 19:19405658-19405680 GGGCGTGGCGACCGAGGGGCGGG - Intronic
1164744245 19:30599422-30599444 GGGAGGGGGAAGGGAGGGACGGG - Intronic
1165879365 19:39031793-39031815 GGTAGCGGGGCCGGAGGGGCGGG - Intronic
1165994511 19:39834194-39834216 GGGAGCGGAGAGGGAGGGATGGG - Intronic
1166766800 19:45255959-45255981 GAGAGAGGCCAGGGAGGGACAGG + Intronic
1167375376 19:49108184-49108206 GGGAGCGACGGCGGAGCCACCGG + Exonic
1168471607 19:56644634-56644656 GGGAGAGACGACGGAGGCAGTGG - Intronic
925188345 2:1864544-1864566 GGGGACGGCGACTGGGGGACAGG - Intronic
925715574 2:6781601-6781623 GGGAGAGGCGAGGGAGGAGCAGG + Intergenic
925802325 2:7613775-7613797 GGGACCAGCGATGGTGGGACAGG - Intergenic
926147469 2:10405405-10405427 TGGAGGGGCCATGGAGGGACAGG - Intronic
926816422 2:16802286-16802308 GAGAGCGGGGACTGAGAGACAGG - Intergenic
928084356 2:28336539-28336561 GGGAGTGCCGAAGGAGGGGCAGG + Intronic
928101288 2:28438955-28438977 GGGAGCGGTGAGGGAGGGAGGGG - Intergenic
929133698 2:38602881-38602903 GGGAGCGGAGACGGAGGAGGAGG - Exonic
929955378 2:46454263-46454285 GGGGGTGGTGACGGAGGGGCAGG - Intronic
934566963 2:95346547-95346569 GGGAGCGGCGATGGAGGCTGGGG + Intronic
935137717 2:100322059-100322081 GGCGGCGGCGGCGGCGGGACCGG + Exonic
935592165 2:104853849-104853871 GGGGGCGGCGGGGGAGGGGCGGG + Intergenic
936686832 2:114837323-114837345 GGGACCCGGAACGGAGGGACCGG - Intronic
937307818 2:120882964-120882986 GAGAGCAGCTACGGAAGGACAGG - Intronic
945683061 2:212936801-212936823 GGGAGCAGGCACGGGGGGACTGG + Intergenic
946519108 2:220446662-220446684 GGGAGGGGAGAAGGAGGGAGAGG - Intergenic
948660105 2:239501738-239501760 GGGAGGGGCAAGGGAGGGAGAGG + Intergenic
948871946 2:240805096-240805118 GGGAGAGGGGAGGGAGGGAGAGG + Intronic
1168814583 20:728137-728159 GGGGGCGGCGCAGGAGGGAAGGG + Intergenic
1168878226 20:1185450-1185472 GGATCCGGGGACGGAGGGACGGG + Intronic
1169061527 20:2663867-2663889 GGGAGCAGCGAGGAAGGGACAGG + Intronic
1169914686 20:10673593-10673615 GGCAGCGGCGACGGCAGCACCGG - Exonic
1171370964 20:24661618-24661640 GGGAGGAGGGAGGGAGGGACTGG + Intronic
1172658327 20:36550033-36550055 GGGACAGGGGACGGAGGGAATGG + Exonic
1173870879 20:46341475-46341497 GGGAGTGGGCAGGGAGGGACGGG - Intergenic
1176071612 20:63229571-63229593 GAGAGCGGAGATGGAGGGCCAGG - Intergenic
1176125432 20:63472757-63472779 GGGAGGGGAGAGGGAGGGACGGG + Intergenic
1177010953 21:15729993-15730015 GAGAGAGGGGACGGAGGGAGCGG - Intergenic
1177674379 21:24277325-24277347 GGGAGGGGAGAGGGAGGGAGTGG - Intergenic
1178487058 21:33025875-33025897 GGCAGCGGCGACGGCGGCAGCGG - Intronic
1178583820 21:33856890-33856912 GGGGGCGATGACGGAGGGAGAGG + Intronic
1178893529 21:36540643-36540665 GAGAGAGGGGAGGGAGGGACTGG + Intronic
1179673204 21:42964201-42964223 GGGAGAGAAGAGGGAGGGACGGG - Intergenic
1179909130 21:44438721-44438743 GGGAGGGGCGACGCGGGGGCAGG + Intronic
1179909589 21:44440931-44440953 GGGAGTGGGGAGGCAGGGACGGG + Intronic
1180069778 21:45430515-45430537 GGGAGCTGCTGAGGAGGGACCGG + Intronic
1180609160 22:17084806-17084828 GGGAGGGACGCCGGAAGGACTGG + Intergenic
1181528462 22:23502814-23502836 GGGACAGGGGATGGAGGGACAGG - Intergenic
1182452578 22:30430011-30430033 GGGAGCTGGGAGGGAGTGACAGG - Intergenic
1182604042 22:31489718-31489740 GGGAGCGGCGGCCGAGGCAAAGG - Intronic
1183545994 22:38455177-38455199 GGGAGCGGCGCGGGACGGCCGGG - Exonic
1183903214 22:41021760-41021782 GGGCGCGGCAAAGGAGGGCCGGG - Intergenic
1184321232 22:43743725-43743747 GTGAGGGGTGAAGGAGGGACTGG - Intronic
1184924235 22:47626104-47626126 GGGAGGAGGGAGGGAGGGACGGG - Intergenic
1185399628 22:50609086-50609108 GGGACCGGGGACGGGGGGTCTGG - Intronic
949556355 3:5156831-5156853 GGGGGCGGGGAGGCAGGGACAGG - Intronic
950433967 3:12967664-12967686 GCGGGCGGCGGCGGAGGGGCGGG - Exonic
951711297 3:25586755-25586777 GGAAGGGGAGAGGGAGGGACAGG - Intronic
953027698 3:39154148-39154170 GGGAGCGGGGAGGCAGGGAGCGG + Intronic
953284889 3:41597004-41597026 GGGAGCTGCAACAGAGAGACTGG - Intronic
954096205 3:48330840-48330862 GAGAGCGGGGACTGAGAGACAGG - Intergenic
954442734 3:50530584-50530606 GGGCGCAGGGACGCAGGGACGGG + Intergenic
954540623 3:51391240-51391262 GGGAGCGGCGCCGAGGGGCCGGG - Intergenic
954575186 3:51671827-51671849 GTGCGCGGCGGCGGAGGGCCGGG - Exonic
954632760 3:52056216-52056238 GGGCGCGGCGACGGGGGCAGGGG - Exonic
954669035 3:52278378-52278400 GGCAGCGGCGGCGCAGGGCCGGG + Exonic
954682801 3:52355069-52355091 GGGAGCGATGAGGGAAGGACTGG - Intronic
955916298 3:63912027-63912049 GCGAGCTGAGAGGGAGGGACCGG + Intronic
956678025 3:71753677-71753699 GGCAGCGGCGGCGGCGGGCCCGG + Intronic
956678123 3:71753992-71754014 GGGAGCGGCGAGGCAGGGGACGG + Intronic
957816267 3:85301376-85301398 GGGAGAGGAGAGGGAGGGAGAGG + Intronic
962129847 3:132660622-132660644 AGGAGCGGCGACGGAGGGGGCGG + Exonic
962378507 3:134877978-134878000 GGGAGCGGTGGCTGAGGGAAGGG + Intronic
962929888 3:140026575-140026597 GGGATGGGAGAAGGAGGGACTGG + Intronic
964790421 3:160449589-160449611 GGGCGCGACGATGGAGGGAGTGG - Intronic
966594122 3:181711396-181711418 GGGAGCGGCACCAGAGGGGCTGG + Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
967033629 3:185631444-185631466 GGGAGGGGAGAGGGAGGGAGGGG - Exonic
967033640 3:185631465-185631487 GGGAGGGGGGAGGGAGGGAGGGG - Exonic
968288843 3:197523743-197523765 GGGAGGGGCACAGGAGGGACGGG + Intronic
968879562 4:3292313-3292335 GGCAGCAGCGAGGGCGGGACCGG - Intergenic
968917211 4:3501824-3501846 GGGAGGGGCGGGGGAAGGACGGG - Intergenic
968938216 4:3624565-3624587 GGGAGCAGCGTGGGAGGGAGAGG + Intergenic
968971555 4:3798258-3798280 GGGAGACGGGACGGAAGGACCGG + Intergenic
969274908 4:6128446-6128468 AGGAGCGGGGAGGGAGGGAAGGG + Intronic
969438451 4:7202082-7202104 GGGAGCGGGGAGAGAGGTACAGG - Intronic
969582551 4:8073538-8073560 GGGAGGGGTGAGGGAGGGAGAGG + Intronic
971351938 4:25862990-25863012 GGGGGCGGCGACGGCGGGAGCGG - Intronic
975870833 4:78776580-78776602 GGCAGCGGCGGCGGAGCGGCGGG + Exonic
977014310 4:91673630-91673652 GGGAGGGAGGAGGGAGGGACAGG - Intergenic
978194483 4:105954815-105954837 GGGAGTGGGGAGTGAGGGACTGG - Intronic
980298671 4:130958317-130958339 GGGACCGCGAACGGAGGGACCGG - Intergenic
980464234 4:133152208-133152230 GGGAGCGGAGGCGGAGGGTCAGG + Exonic
982189733 4:152841995-152842017 GAGAGCGGGGACTGAGAGACAGG + Intronic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
986693740 5:10333965-10333987 GGCAGCGGCGACCCAGGGGCTGG + Intergenic
986773479 5:10994295-10994317 GGGGGCGGGGACGGAGGAAGGGG + Intronic
986773560 5:10994470-10994492 GGGGGCGGGGAAGGAGGGGCGGG + Intronic
987132326 5:14871508-14871530 GCGAGGGGCGACGGGGCGACGGG + Exonic
988550985 5:32200626-32200648 GGGAGGGGGGAAGGAGGGAAGGG + Intergenic
990892752 5:60665689-60665711 GGAAGCGGGGACCGAGAGACAGG + Intronic
991371652 5:65925849-65925871 GGGAGGGAGGACGGAGGGAGCGG - Intergenic
992325258 5:75654179-75654201 GGGAGGGGAGACGAGGGGACAGG - Intronic
995815007 5:116158164-116158186 GAGAGGGGAGACGGAGGGAGAGG - Intronic
996487819 5:124057408-124057430 GGGAGCGGGTAGGGAGGCACTGG + Intergenic
998026070 5:138818007-138818029 GGGGGCGGGGGCGCAGGGACGGG - Intronic
998039818 5:138944989-138945011 GGGAGCGAGGATGGAGGAACGGG - Intergenic
998295594 5:140966603-140966625 GGGAGGGCCTACGGAGGGAGCGG + Exonic
1001652936 5:173328258-173328280 GGAAGCGGCGAAGGAGGAAGAGG - Exonic
1002211191 5:177600261-177600283 GTGAGCGGCGGCGGTGGGCCCGG + Intronic
1002425269 5:179171284-179171306 GGGAGCAGCGTCTGTGGGACCGG - Intronic
1002791316 6:440280-440302 GGGAGCGGGGAGGAAGGGATGGG - Intergenic
1003153189 6:3570088-3570110 GGGAGAGGAGAGGGAGGGAGGGG - Intergenic
1003518451 6:6837065-6837087 GGGAGAGGGGAGGGAGGGAGGGG + Intergenic
1004504726 6:16238650-16238672 GGCGGCGGCGACGGCGGGGCGGG - Exonic
1005719480 6:28587178-28587200 GGGAGCTGCGGCCGAGGGAAGGG - Exonic
1006293946 6:33161550-33161572 GGGAGAGGCGTCTGAGGGACCGG + Intergenic
1006499386 6:34448295-34448317 GGGTGGGGCGAGGGAGGGAAAGG + Intergenic
1006860739 6:37170226-37170248 GGCAGCGGCGGCGGCGGGACCGG + Exonic
1008024205 6:46615993-46616015 GGGAGGGGGGAGGGAGGGAAAGG - Intronic
1011077250 6:83450065-83450087 GAGAGCGGGGACTGAGAGACAGG + Intergenic
1011554075 6:88556751-88556773 GGGAGTTGAGACGGAGGAACTGG + Intergenic
1012051524 6:94351206-94351228 GGGAGCGGGGGCGGGGGGAGGGG + Intergenic
1017616933 6:156255799-156255821 GGGAGAGGCGACAGTGGGAAAGG - Intergenic
1018898005 6:168034678-168034700 AGGAAGGGCGACGGAAGGACGGG - Intronic
1019213304 6:170423359-170423381 GGCAGCAGCGAGGGAGGGCCAGG - Intergenic
1019290543 7:248100-248122 GGGAGAGGCCCCTGAGGGACTGG - Intronic
1019768951 7:2871316-2871338 GGGAGCACCGACCAAGGGACTGG + Intergenic
1020037535 7:4973936-4973958 GGGTGCTGCGGAGGAGGGACCGG - Intergenic
1020238448 7:6374415-6374437 GGGAGCGGCGCGGGCGGGAGCGG + Intergenic
1020238453 7:6374430-6374452 GGGAGCGGCGCGGGCGGGAGCGG + Intergenic
1022285970 7:28956544-28956566 GGCGGCAGCGACGGAGGGGCTGG + Exonic
1022383871 7:29884362-29884384 GGGAGCGGGGGCGGCGGGGCGGG - Exonic
1022569949 7:31442534-31442556 CAGAGAGGAGACGGAGGGACAGG + Intergenic
1024074933 7:45813452-45813474 GGGATCAGCGTGGGAGGGACCGG - Intergenic
1024255608 7:47537947-47537969 GGGTGCGGTGAGGGAGGGATAGG - Intronic
1026843262 7:73682869-73682891 GGGAACGGCGCCTGAGGGCCCGG - Exonic
1026906036 7:74063313-74063335 GGCAGCGGCGGCGGCGGGTCCGG - Exonic
1026955284 7:74372876-74372898 GGGGGCGGGGACGCAGGGAGGGG - Intronic
1027177786 7:75915495-75915517 GGGGGCGGCGGCGCGGGGACTGG - Intronic
1027244660 7:76358954-76358976 TGGAGCTGCGACCGCGGGACCGG + Exonic
1029110751 7:98212011-98212033 GGGAAGGGGGACGCAGGGACAGG + Intronic
1029207665 7:98878989-98879011 GGGGGCGCCTCCGGAGGGACAGG - Intronic
1029390695 7:100272076-100272098 GGGGGCGGCGGCGGCCGGACCGG + Exonic
1030348249 7:108456462-108456484 GGGAGCGGAGAGGGCGGGAGCGG - Intronic
1034179523 7:149126542-149126564 GGGAGGGGAAACGGAGGGGCAGG + Intronic
1034965666 7:155389114-155389136 GGGAGCGGGTAGGGAGGGGCAGG + Intronic
1035153307 7:156892862-156892884 GGGGGCGGGGACGGAGGGCCCGG + Intronic
1035686956 8:1530748-1530770 GGGACCCCAGACGGAGGGACTGG - Intronic
1036426478 8:8649614-8649636 GGGAGCAGCGAGGCAGGGAGGGG - Intergenic
1037308502 8:17530296-17530318 GGGAGCCGGGACAGAGGGAGAGG + Intronic
1037753252 8:21696131-21696153 GGGAGAGGGGACAGAGGGAGAGG - Intronic
1037799511 8:22024788-22024810 GGGAGCGCCGATGGCGTGACTGG + Exonic
1038311515 8:26449368-26449390 GGGAGAGGAGAAGGAGGGAGGGG + Intronic
1039912092 8:41833931-41833953 GGAAGAGGCTGCGGAGGGACGGG + Intronic
1041288259 8:56282944-56282966 GGGAGCGACGTCTTAGGGACTGG - Intergenic
1042564571 8:70099072-70099094 GGGAGGGGAGAAGGAGGGAGGGG + Intergenic
1043885224 8:85591639-85591661 GGGAGGGGCGGGGGAGGGGCAGG - Intergenic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1045564355 8:103298768-103298790 GGCGGCGGCGGCGGCGGGACTGG - Intronic
1047951565 8:129939713-129939735 GGGAGCGGCGGCAGCCGGACCGG + Exonic
1049090762 8:140511846-140511868 GGGAGCGGCGAGGGGTGGGCGGG - Intronic
1049361061 8:142212814-142212836 GGGACAGGAGAGGGAGGGACAGG - Intronic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1049780883 8:144428425-144428447 GGGAGAGGCGACTCAGGGCCTGG - Intronic
1049960387 9:732631-732653 GGGAGGGGCAAGGGAGGGAAGGG - Intronic
1050270624 9:3940733-3940755 GGGAGCAGCGATGGAGGAAAAGG + Intronic
1050734549 9:8748185-8748207 GAGAGCGGGGACTGAGAGACAGG + Intronic
1050906402 9:11011920-11011942 GGGAGCGGCCACGGTGGGGAGGG + Intergenic
1051774820 9:20622086-20622108 GGGAGCGGAGGCTGAGGGAGAGG + Intronic
1052114234 9:24629586-24629608 GGGAGGGGTGGCGGAGGGAGTGG + Intergenic
1052922379 9:33981818-33981840 GGAAGCGGGGAAGGAGGGAAGGG + Intronic
1054452979 9:65413194-65413216 GGGAGCAGCGTGGGAGGGAGAGG - Intergenic
1055030644 9:71768986-71769008 GGGAGCGGGGCCGGCGGGAGGGG - Intronic
1055545293 9:77364649-77364671 GGGAGAGGGGACAGAGGGAATGG + Intronic
1057488653 9:95506158-95506180 GAGAGCGGCGGGGGCGGGACGGG - Intronic
1057547269 9:96027635-96027657 TGGAGTGGCGCCGGGGGGACGGG - Intergenic
1059942261 9:119369538-119369560 GGGAGCGGCGGCCGGGGGGCGGG + Intergenic
1060106731 9:120877257-120877279 GGGGGAGGCGGCGGAGGGAGGGG + Exonic
1060770173 9:126326812-126326834 GGCGGCGGCGGCGGAGGGGCGGG - Intergenic
1061196757 9:129110834-129110856 AGGGGCGGGGACGGAGGGGCGGG + Intronic
1061262621 9:129488517-129488539 GGGGGCGGGGACGCCGGGACGGG - Intergenic
1061293331 9:129664849-129664871 GGGCAGGGCGACAGAGGGACGGG + Intergenic
1061853632 9:133429701-133429723 GGGAGCGGCGACGGAGGGACGGG - Intronic
1061912695 9:133733492-133733514 GGGAGTGGAGAAGGACGGACGGG - Intronic
1061975958 9:134068150-134068172 GGGCGCGGCGCCGGCGGGGCCGG - Intronic
1062344792 9:136109704-136109726 GGGAGCGGCCCCGCAGGGAGGGG + Intergenic
1062613115 9:137383815-137383837 GGGGGCGGCGCGGGAGGGCCGGG - Intronic
1062613813 9:137387145-137387167 GGGAGCGGGGGCCGAGGGCCAGG - Intronic
1185459558 X:328372-328394 GGGAGGGGGGACGGGGGGGCGGG - Intergenic
1185459648 X:328544-328566 GGGAGGGGGGACGGGGGGGCGGG - Intergenic
1187048664 X:15675037-15675059 GGGAACGGCCACGGCGGGAACGG + Intergenic
1187281597 X:17861423-17861445 GGCGGCGGCGGAGGAGGGACAGG + Intergenic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1190687418 X:52887487-52887509 GGGAGTGGGGTCGGGGGGACGGG + Intergenic
1190698564 X:52968305-52968327 GGGAGTGGGGTCGGGGGGACGGG - Intronic
1196808029 X:119605917-119605939 GGCAGCGGCGGCGGCGGGAGGGG + Intergenic
1197226702 X:123961680-123961702 GGGAGGGGGGAGGGAGGGAAGGG - Intronic
1199679502 X:150215357-150215379 GGGAGGGGGGATGGAGGGAGGGG + Intergenic
1199695729 X:150341692-150341714 GGGAGGGGGGATGGAGGGAGGGG - Intergenic
1199880962 X:151974208-151974230 GGGAGCGGCCCCGGGGTGACCGG - Intronic
1200115290 X:153767334-153767356 GGGAGTGGCAACGGTGGGGCTGG + Exonic
1200117263 X:153774809-153774831 GGGTGCGGAGGCGGGGGGACAGG + Intronic
1200126746 X:153818880-153818902 GGGAGGGGGGACACAGGGACAGG + Intronic