ID: 1061853810

View in Genome Browser
Species Human (GRCh38)
Location 9:133430472-133430494
Sequence TACCAGCCCCACTTCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061853810_1061853818 -4 Left 1061853810 9:133430472-133430494 CCACAGCAGAAGTGGGGCTGGTA 0: 1
1: 0
2: 1
3: 24
4: 205
Right 1061853818 9:133430491-133430513 GGTAGGGGGAGGGGAGATGAAGG No data
1061853810_1061853819 4 Left 1061853810 9:133430472-133430494 CCACAGCAGAAGTGGGGCTGGTA 0: 1
1: 0
2: 1
3: 24
4: 205
Right 1061853819 9:133430499-133430521 GAGGGGAGATGAAGGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061853810 Original CRISPR TACCAGCCCCACTTCTGCTG TGG (reversed) Intronic
900415070 1:2531029-2531051 GAGCAGCCCCAGTGCTGCTGTGG - Intergenic
900806033 1:4769061-4769083 TACCTGCCCCACTTCTGAAGTGG + Intronic
901110569 1:6790269-6790291 CACCACCCCCACTCCTGCTGAGG - Intronic
901676419 1:10888606-10888628 CTCCTGCCCCTCTTCTGCTGTGG - Intergenic
902218461 1:14949675-14949697 CTCCAGCCCCACTTCACCTGAGG - Intronic
903581477 1:24374074-24374096 TTCCAGGCTCACTTCTGCTAAGG + Intronic
903821145 1:26103459-26103481 CCCCAGCCCCATTTCTGCAGGGG - Intergenic
904401413 1:30259103-30259125 TCCCACCCCCACTTCAGCAGGGG + Intergenic
905979457 1:42210748-42210770 TACCAGCACCAGCTCTGATGGGG - Intronic
907722105 1:56981741-56981763 TACCAACTCTACTTCTGCTAAGG - Intergenic
910226670 1:84942918-84942940 TCGGAGCCCCACTTCTGGTGAGG - Intronic
910880344 1:91917454-91917476 TACCAAGGCCACTTCTGCTTTGG - Intergenic
913075585 1:115338351-115338373 CACCAGCCCCGCACCTGCTGTGG + Intergenic
913155388 1:116092194-116092216 TACCAGCACCAGCTCTGTTGGGG + Intergenic
916166995 1:161973308-161973330 CACCAGCTTCACTTCTGCCGGGG - Intergenic
917413562 1:174784499-174784521 TACCAGTCCCACGCTTGCTGGGG - Intronic
918569168 1:185967706-185967728 TTCCAGTCCCACCTCTGCTGAGG + Intronic
919054981 1:192559326-192559348 AACCAGCCTCACTGCTGATGTGG - Intergenic
920931810 1:210395579-210395601 TAACAACTCCACTTCTGTTGGGG - Intronic
921842963 1:219847616-219847638 TACCAGCACCTGCTCTGCTGTGG - Intronic
1063232339 10:4077464-4077486 TACCACCCCTACTTCTGTTTTGG - Intergenic
1063372724 10:5532280-5532302 TCCCAACCCCAGTTCTGCTGAGG + Intergenic
1065878095 10:30014326-30014348 TACCAGACCCATTTATGCAGGGG - Exonic
1067545179 10:47187792-47187814 GACCAGGCCCACTTCACCTGGGG - Intergenic
1068405658 10:56585581-56585603 TACCAGCACCAGCTCTGATGGGG + Intergenic
1069622744 10:69847859-69847881 GACCAGCCCCACATCCACTGAGG - Intronic
1069694081 10:70374104-70374126 CACCTGCCCCAGTGCTGCTGTGG + Intronic
1069840634 10:71337261-71337283 TACCAGCCCCACCCCTTATGGGG + Intronic
1072631071 10:97146847-97146869 TGCTAACCCCACTTGTGCTGGGG + Intronic
1072706120 10:97682270-97682292 TCCCAGCCCCAGGCCTGCTGGGG + Intronic
1075289564 10:121216707-121216729 TCCCAGCCCCTCTTCTGCCCTGG - Intergenic
1076312741 10:129520302-129520324 TAGCAGCCCCACTCCTCCTCTGG - Intronic
1079308645 11:19345663-19345685 GCCCAGCCCCGCATCTGCTGGGG - Intergenic
1081592648 11:44435541-44435563 TCCCCTTCCCACTTCTGCTGGGG + Intergenic
1082087879 11:48064963-48064985 TCTCAGCCCCACTGGTGCTGTGG - Intronic
1082270979 11:50169353-50169375 TTCCAGCTCCACTACTGCTTTGG + Intergenic
1083422670 11:62563895-62563917 TCCCAGCCCCAGTTTTGGTGTGG - Intronic
1083582366 11:63833024-63833046 CTCCAGCCCCACATCTGGTGGGG + Intergenic
1083775918 11:64894296-64894318 CTCCAGCCCCACTCCTGATGTGG - Intergenic
1083993611 11:66261299-66261321 CTCCATCCCCACTTCTGCTGAGG - Intronic
1084472549 11:69371638-69371660 TACCATCCCCATTACAGCTGAGG - Intergenic
1086877310 11:92112192-92112214 TACCAGCACCAGCTCTGATGGGG - Intergenic
1088180438 11:107103532-107103554 TACCAGCACCAGCTCTGATGAGG - Intergenic
1089439894 11:118506419-118506441 AGCCAGCCCCACCTCTCCTGGGG + Exonic
1093019173 12:14187251-14187273 TAACAGCACCACTTCTGCCACGG - Intergenic
1093460461 12:19402965-19402987 TACCAGCACCAGCTCTGATGGGG + Intergenic
1095777278 12:46024050-46024072 TACCAGCACCAGCTCTGATGAGG + Intergenic
1096217818 12:49808282-49808304 TCCTAGCCCCACTCCAGCTGGGG - Intronic
1096230953 12:49896711-49896733 TTCCAGCCCCACTTCCTCTTAGG + Intronic
1097708771 12:62895819-62895841 CACCTGCTCCACTTCTGATGAGG - Intronic
1102567919 12:113809101-113809123 CACCTGCCCCACTTCTCCTTTGG + Intergenic
1103593322 12:122007551-122007573 TCCCAGCCCCACTTCACCTATGG + Intergenic
1104426782 12:128684471-128684493 TGCCCGCCCCACTTTGGCTGAGG - Intronic
1104741330 12:131177000-131177022 TACCAGCACCAGCTCTGATGAGG - Intergenic
1105401492 13:20100131-20100153 TAGCAGCCCCCCTTCTCCTCGGG + Intergenic
1107396829 13:40026843-40026865 TACTAACCACACTTCTTCTGTGG - Intergenic
1107430273 13:40334233-40334255 TCCCTGCCCCACCTCTGCTGGGG - Intergenic
1107556723 13:41521858-41521880 TACCAGCCTCACCTCTGCTGAGG + Intergenic
1110209308 13:72953521-72953543 TACCAGCACCAGTTCTGATGGGG + Intronic
1111416832 13:87957556-87957578 TACCAACCCCAATTCTGAGGGGG - Intergenic
1114446933 14:22795861-22795883 TACCTGCCCAGCTTCTTCTGAGG + Intronic
1114697891 14:24644557-24644579 TACCAGCACCAGCTCTGATGGGG - Intergenic
1117579420 14:57137174-57137196 TCCCAGCCACACTTAGGCTGGGG - Intergenic
1119263356 14:73251020-73251042 AACCACCCCCACCTCGGCTGAGG - Exonic
1119967016 14:78928088-78928110 TAACAACCCCACTATTGCTGTGG - Intronic
1120522393 14:85539205-85539227 TACCTGCCTCACTTCTGATTGGG + Intronic
1122238575 14:100346722-100346744 TAAGAGGCCCACTGCTGCTGTGG - Intronic
1122457385 14:101864913-101864935 GACCAGCTCAACATCTGCTGCGG + Intronic
1123092005 14:105746105-105746127 TACCAGCCCCTGCTCTCCTGTGG + Intergenic
1125481231 15:40082326-40082348 TACCAGCCTCCCTGCTCCTGAGG - Intergenic
1126109937 15:45169180-45169202 TGCCAGCCTCACTTCTCCGGGGG - Intronic
1126674396 15:51146887-51146909 TCCAATCCCCACTTCTGCTCAGG - Intergenic
1128392935 15:67195324-67195346 TACCAGGCCACATTCTGCTGTGG + Intergenic
1128557974 15:68644700-68644722 TCCCCACCCCACTCCTGCTGTGG + Intronic
1128749713 15:70140252-70140274 TTCCAGCCCCTCCTCTGCTCTGG - Intergenic
1129141575 15:73602959-73602981 TACCAGCCAGCCTTCTGCTTTGG + Intronic
1129415582 15:75376161-75376183 TACCAGCTACAGTTCTGCTTTGG + Intronic
1130081727 15:80739670-80739692 TACTTGCTCCACTTCTGGTGAGG - Intronic
1130814704 15:87419222-87419244 CACCTGTCCAACTTCTGCTGAGG + Intergenic
1132115362 15:99131794-99131816 TACCTCCACCACTTCTGCAGTGG - Exonic
1132882350 16:2168017-2168039 CACCTCCCCCACATCTGCTGAGG + Intronic
1135654014 16:24232191-24232213 TTCCAGAACCACTTCTGCTAAGG + Intergenic
1136418324 16:30116861-30116883 CCCCAGCCCCACTGCTGCTGGGG + Intronic
1137842422 16:51652784-51652806 TACCAGCCACAGTTCTGCACCGG - Intergenic
1138417328 16:56878994-56879016 TTCCAGCCCCACCTCTGCAGAGG - Intronic
1141048994 16:80743839-80743861 TATCAGCACCATTTCTTCTGGGG - Intronic
1141093695 16:81148078-81148100 CCTCACCCCCACTTCTGCTGAGG + Intergenic
1142304746 16:89278914-89278936 ACACAGCCCCACTTCTGCTGTGG - Intronic
1144952556 17:19002058-19002080 GACCCGCCCCACACCTGCTGTGG - Intronic
1145975520 17:28981716-28981738 TACCAGCCCCACTCCAGCCATGG - Exonic
1147321114 17:39646733-39646755 TACCAGCCCCACTTGTAATAGGG - Intronic
1150123205 17:62620067-62620089 TGCCAGCCCAACTACAGCTGTGG + Intergenic
1151944063 17:77309877-77309899 TCCTAGCCCCACTCCTGCTGCGG + Intronic
1152200060 17:78940020-78940042 CAACAACCCCATTTCTGCTGGGG - Intergenic
1158163868 18:54517268-54517290 CACCATCCCTAATTCTGCTGGGG - Intergenic
1159766982 18:72502817-72502839 TCCCAGCCCCACTTCCGATCTGG - Intergenic
1160532079 18:79571499-79571521 CACCACCCCCACTTCTGCCTCGG - Intergenic
1161640288 19:5418483-5418505 AACCACCCCCAGTTCTGCGGGGG + Intergenic
1163194171 19:15702970-15702992 TACCAGCCCCAGCTCTGATGGGG - Intergenic
1163591409 19:18196159-18196181 TCCCAGCACCACTTCAGCTCCGG + Exonic
1164279564 19:23757757-23757779 TCCCTGCCCCAGTTCTGCTCAGG - Intronic
1164821544 19:31254956-31254978 TTCCTTCCCCACTCCTGCTGAGG - Intergenic
1165333860 19:35155658-35155680 GGCCAGCCCCACGTGTGCTGCGG + Intronic
1167374052 19:49101874-49101896 GCCCAGCCCCAGTTCTACTGGGG - Intronic
1167821460 19:51932161-51932183 TACCTGCCCCAGCTTTGCTGAGG - Intronic
925905250 2:8536273-8536295 TACCCGCCCCACTGCTGCCTCGG + Intergenic
926173668 2:10570029-10570051 ACCCAGCCCCATTTGTGCTGTGG - Intergenic
929531279 2:42754587-42754609 TGCCAGCCTCACATCTGCTCAGG - Exonic
929877964 2:45812760-45812782 TACCACCACCACTACTGCTATGG - Intronic
930224751 2:48780750-48780772 ATCCAGCCCCACTGCAGCTGTGG - Intergenic
932593634 2:73081201-73081223 CTCCAGCCCCACTCCTGCAGGGG + Intronic
932882477 2:75516746-75516768 TGCCAGCCCCACTTCATTTGGGG + Intronic
934772557 2:96916552-96916574 TGCCATCCCCACTTCTGTTCAGG - Intronic
939558862 2:143710318-143710340 TACCAGGCCAAATTCTGCTATGG - Intronic
940592075 2:155742257-155742279 TACCTTCCCCATTTCTGGTGAGG - Intergenic
941466764 2:165837423-165837445 TCACAGCCCCTCCTCTGCTGCGG - Intergenic
943446675 2:187995253-187995275 TACCAGCGCCAGCTCTGATGAGG - Intergenic
946517183 2:220425533-220425555 CACATGCCCCACTGCTGCTGTGG + Intergenic
947102399 2:226635557-226635579 TAACAGCCCAACTTTTGCTTTGG + Intergenic
948886073 2:240885566-240885588 TACCAGCCCCCATTCTAATGGGG + Intergenic
1169077420 20:2769748-2769770 TACCAGCCCTACTTCTTGGGTGG + Intergenic
1170791692 20:19514186-19514208 ATCCAGGCCCAGTTCTGCTGGGG - Intronic
1171879019 20:30602993-30603015 TACCTGCCCCAAGGCTGCTGAGG - Intergenic
1174922212 20:54716173-54716195 TACCAGACACATTTCTGGTGGGG - Intergenic
1177996247 21:28102947-28102969 TACCAGCCCCATTTCTCCTTTGG - Intergenic
1178388977 21:32182983-32183005 CTCCAGCCCCATTTCTTCTGGGG + Intergenic
1178537677 21:33423902-33423924 TGCCAGCTCCTCGTCTGCTGTGG + Intronic
1179949966 21:44703903-44703925 TTCCAGCTCCACTGCAGCTGGGG - Intronic
1180130810 21:45825782-45825804 CACCAACCCCACCTCTGCTGGGG - Intronic
1180193479 21:46180613-46180635 TCCCAACCCCAGTTCTGCTGAGG + Intronic
1181005864 22:20013225-20013247 GAACACGCCCACTTCTGCTGTGG + Intronic
1181340860 22:22178846-22178868 GAGCAGCCCCTCCTCTGCTGGGG + Intergenic
1181373035 22:22432766-22432788 TCACAGACCCACTTCTGTTGGGG + Intergenic
1181851962 22:25755783-25755805 TGCCAGCTCCCCTTCTCCTGCGG + Intronic
1184189399 22:42884915-42884937 CCCCAGCCCCACCTTTGCTGTGG - Intronic
1184782517 22:46656288-46656310 CACCAGCCCCACTCCCACTGGGG - Intronic
952818772 3:37468119-37468141 TTCCAGCCCTGCTTCTGCTTGGG + Intronic
955006868 3:54976799-54976821 TCCCACTCCCACTTCTGGTGTGG - Intronic
959311316 3:104741101-104741123 TGGTAGCCCCACTTCTGCAGTGG + Intergenic
962868513 3:139467815-139467837 CACCATTCCCACTTCTCCTGTGG - Intronic
963018737 3:140851048-140851070 TAAGAGCACCACCTCTGCTGGGG - Intergenic
964635946 3:158858799-158858821 TACCAGCACCAGGTCTGATGGGG + Intergenic
965216830 3:165874602-165874624 TACCAGCACCTGTTCTGGTGGGG + Intergenic
968490266 4:886398-886420 CACCATCCCCACAGCTGCTGGGG + Intronic
968490720 4:889279-889301 TCCCAGCCCCAGCTGTGCTGAGG - Intronic
968557033 4:1250680-1250702 TACCACCCCCACTTCCCCAGGGG + Intergenic
969248547 4:5952476-5952498 GACCAGCCCCGCTGCTTCTGAGG - Intronic
969341384 4:6543838-6543860 TACCACCCCCAGTACTGCTTGGG - Intronic
972339586 4:38139950-38139972 GCCCAGGCCCACTTCTGCAGTGG - Intergenic
973865213 4:55106039-55106061 TGCCATTCCCACTTCTGCAGCGG + Intronic
975290976 4:72678051-72678073 TACCAGCACCACCTTTGATGTGG + Intergenic
975647820 4:76563010-76563032 TTCCAGTCTCAGTTCTGCTGTGG + Intronic
977510168 4:97952649-97952671 TACCAGCACCATCTCTGATGGGG + Intronic
978605537 4:110475609-110475631 TTCCAGCTCCACTACTGCTTTGG + Intronic
986225436 5:5807549-5807571 CACCAGCCCAGTTTCTGCTGTGG + Intergenic
986354754 5:6912903-6912925 AACCATCCCTACTTCTTCTGGGG - Intergenic
986916152 5:12623422-12623444 TACCAGCATCAGTTCTGATGGGG + Intergenic
987029298 5:13961048-13961070 CCCCAGGCCCAGTTCTGCTGTGG + Intergenic
987084535 5:14456359-14456381 CACCACCTCCACTTCTGCTCTGG - Intronic
992720205 5:79553224-79553246 TACCAGCCCCATTTCCCATGAGG + Intergenic
997200682 5:132008408-132008430 GGCCAGCCCCACTTCTCCTAAGG + Intronic
997963414 5:138338835-138338857 TCCCAGCCCCACACCTCCTGGGG - Intronic
999113491 5:149141794-149141816 TGCCAACCCCACTTCTGCCCGGG + Exonic
999211838 5:149896419-149896441 TACCAGCTCCAGTTCTGTTAGGG + Exonic
999437845 5:151577938-151577960 CTCTAGCCCCACTTCTTCTGGGG + Intergenic
1002422344 5:179155159-179155181 TAACAGCCACACTGCAGCTGGGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1002586436 5:180251817-180251839 CACCTGCCCCACTCATGCTGCGG - Intronic
1002680470 5:180959183-180959205 TACCAGCACCAGCTCTGATGAGG + Intergenic
1002845378 6:940316-940338 TCCCCGCCCCACCCCTGCTGGGG + Intergenic
1005395436 6:25377575-25377597 TACCAGCACCAGTTCTGATGGGG + Intronic
1006524774 6:34594526-34594548 GAACAGCCCCACATCTGCTAGGG + Intronic
1006852788 6:37111346-37111368 TACCCGCCCCACCTGTGCTCTGG - Intergenic
1007213699 6:40219316-40219338 TCCCAGCTCAAGTTCTGCTGAGG + Intergenic
1007631598 6:43275959-43275981 TACCAGTCCCGCTTCTCCGGGGG - Intronic
1008540325 6:52541143-52541165 TTCCAGTCCCAAGTCTGCTGTGG + Intronic
1009614775 6:65990534-65990556 TACCAGCACCAGCTCTGATGAGG - Intergenic
1013495044 6:110689716-110689738 TACCAGCACCAAGTCTGATGAGG - Intronic
1016737049 6:147490477-147490499 TTCCAGCCCCACTTCAGAAGAGG - Intergenic
1018278012 6:162153671-162153693 TTCCAGCTCCCCCTCTGCTGAGG - Intronic
1019470120 7:1215023-1215045 GGGAAGCCCCACTTCTGCTGGGG + Intergenic
1023510361 7:40945918-40945940 TACCAGCACCAACTCTGATGGGG + Intergenic
1024306183 7:47931413-47931435 AAACAGCCCCACTGCTACTGAGG + Intronic
1025158277 7:56630157-56630179 TAACAGGCCCACTTCTGCTCTGG + Intergenic
1025728319 7:64088018-64088040 TAACAGGCCCACTTCTGTTCTGG - Intronic
1025757418 7:64357866-64357888 TAACAGGCCCACTTCGGCTCTGG - Intergenic
1026268206 7:68813716-68813738 TGCCAGCCCCACCTCCCCTGAGG + Intergenic
1026734742 7:72942426-72942448 GGCCAGCGCCACCTCTGCTGTGG + Exonic
1026785076 7:73297338-73297360 GGCCAGCGCCACCTCTGCTGTGG + Intergenic
1027109003 7:75422592-75422614 GGCCAGCGCCACCTCTGCTGTGG - Exonic
1031075398 7:117207478-117207500 TACCAGGCCCACTTCTTCTCAGG + Intronic
1031641924 7:124175035-124175057 TATCAGCCCAACTTCTGGAGAGG - Intergenic
1032512967 7:132486661-132486683 CACCAGCCCCACCACTGCTCTGG + Intronic
1032708911 7:134445783-134445805 TACCATCTCCTCTTCGGCTGTGG - Intronic
1032710064 7:134453361-134453383 GTCCAGCCCCGGTTCTGCTGGGG + Intronic
1034273395 7:149813917-149813939 TGCCTGCCCCACATCTGCTCAGG - Intergenic
1038153505 8:24964350-24964372 TTCCAGCCCCATTTCTGTTCTGG - Intergenic
1038410365 8:27353823-27353845 TAGCAGGCCCATTTCTGCTGAGG - Intronic
1040372943 8:46794968-46794990 TAACAGGCCCACATCTGCTTTGG - Intergenic
1040423238 8:47260238-47260260 TCTCAGGCCCACTTCTCCTGCGG + Intergenic
1041327627 8:56685762-56685784 TACCAGCCCCTCCCCTACTGGGG - Intergenic
1042896085 8:73669585-73669607 TGCCAGGCACACTTCTACTGCGG + Intronic
1045232149 8:100315937-100315959 TTCCAGCCACACTTATGCTGTGG - Intronic
1046986155 8:120390986-120391008 TACCACCACCAGTTCTGATGGGG + Intronic
1047368725 8:124237134-124237156 TCCCAACCCTTCTTCTGCTGAGG - Intergenic
1048879870 8:138863453-138863475 TCCCAGCCCCACCTCTGCTCAGG + Intronic
1049209966 8:141381430-141381452 CACCAGGCACACATCTGCTGTGG + Intergenic
1050625941 9:7503661-7503683 TACCACTCCCACTTCTGATTTGG + Intergenic
1051215501 9:14793514-14793536 TACCAGAGCCACCACTGCTGTGG + Intronic
1054709404 9:68496348-68496370 TCCCAGCACCATGTCTGCTGAGG - Intronic
1057340571 9:94197884-94197906 TACCAACACCCCTTCTGATGCGG + Intergenic
1059833948 9:118129178-118129200 TACCAGCACCAGCTCTGATGGGG - Intergenic
1061133555 9:128721251-128721273 AACCTGGCCCACTTCTTCTGTGG - Exonic
1061160190 9:128889321-128889343 CACCAGCCTCACAACTGCTGGGG - Intronic
1061853810 9:133430472-133430494 TACCAGCCCCACTTCTGCTGTGG - Intronic
1062197748 9:135283787-135283809 TCTCAGCCCCTCCTCTGCTGTGG + Intergenic
1062267251 9:135692843-135692865 GACCAGCACCACCTGTGCTGTGG + Intergenic
1186435163 X:9536774-9536796 GCCCAGCTCCCCTTCTGCTGAGG - Intronic
1188443653 X:30235057-30235079 TACATGCCCCAGTTCTGCAGAGG + Intronic
1188956139 X:36436704-36436726 TACCAGCACCAGCTCTGATGGGG - Intergenic
1189168028 X:38880729-38880751 TCCCAGCCCCACTAGTGCTGGGG - Intergenic
1189752333 X:44235033-44235055 CACTATCCCCACTTCCGCTGTGG - Intronic
1193144595 X:78064050-78064072 TTTCAGCTCCCCTTCTGCTGAGG - Intergenic
1196599434 X:117584907-117584929 TACCAGCACCAACTCTGATGAGG + Intergenic
1197110761 X:122771531-122771553 CCCCATCCCCACTACTGCTGGGG - Intergenic
1200845540 Y:7828819-7828841 TAACAGGCCCACTTCTGCTCTGG + Intergenic
1200852840 Y:7903626-7903648 TAACAGGCCCACTTCTGCTCTGG + Intergenic
1200906226 Y:8485443-8485465 TAACAGGCCCATTTCTGCTCTGG - Intergenic
1202257002 Y:22931966-22931988 TAACAGGCCCACTTTTGCTCTGG - Intergenic
1202409993 Y:24565714-24565736 TAACAGGCCCACTTTTGCTCTGG - Intergenic
1202460789 Y:25104358-25104380 TAACAGGCCCACTTTTGCTCTGG + Intergenic