ID: 1061855646

View in Genome Browser
Species Human (GRCh38)
Location 9:133440629-133440651
Sequence CATTCAGCGGTCACTTACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061855642_1061855646 -4 Left 1061855642 9:133440610-133440632 CCTGATTCGTTCATTTATTCATT 0: 1
1: 1
2: 37
3: 307
4: 1108
Right 1061855646 9:133440629-133440651 CATTCAGCGGTCACTTACAGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1061855639_1061855646 6 Left 1061855639 9:133440600-133440622 CCATCCATTCCCTGATTCGTTCA 0: 1
1: 0
2: 1
3: 38
4: 449
Right 1061855646 9:133440629-133440651 CATTCAGCGGTCACTTACAGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1061855641_1061855646 -3 Left 1061855641 9:133440609-133440631 CCCTGATTCGTTCATTTATTCAT 0: 1
1: 0
2: 20
3: 291
4: 1278
Right 1061855646 9:133440629-133440651 CATTCAGCGGTCACTTACAGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1061855640_1061855646 2 Left 1061855640 9:133440604-133440626 CCATTCCCTGATTCGTTCATTTA 0: 1
1: 0
2: 1
3: 45
4: 474
Right 1061855646 9:133440629-133440651 CATTCAGCGGTCACTTACAGGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061855646 Original CRISPR CATTCAGCGGTCACTTACAG GGG Intronic
901396947 1:8988570-8988592 CATTCAGATATCACTTACTGAGG - Intergenic
901610664 1:10495450-10495472 AAGTCAGAGGTCACTGACAGAGG - Intronic
903572344 1:24315522-24315544 CTCTCAGTGCTCACTTACAGTGG + Intergenic
908000987 1:59678839-59678861 CATTCAGCAGTCATTTTAAGGGG + Intronic
911229059 1:95340743-95340765 CATTCATGGATCACTTACAAGGG - Intergenic
912251092 1:108013260-108013282 CCTTCTGTTGTCACTTACAGAGG + Intergenic
919311274 1:195912922-195912944 TATACAGCTGACACTTACAGGGG + Intergenic
1068438178 10:57017689-57017711 CAACCAGCTGTCCCTTACAGGGG - Intergenic
1070642972 10:78182274-78182296 CAGTTAGCGGGCACTTACCGTGG - Intergenic
1080293093 11:30693388-30693410 CATTCAGCTCCCACTTACAGGGG - Intergenic
1080740238 11:35057255-35057277 CATTCAGCAAACACTTATAGAGG + Intergenic
1090593132 11:128293387-128293409 CATTCAGTGGTGATTTCCAGGGG - Intergenic
1092742765 12:11646481-11646503 CATTCAGTGTTCAATAACAGTGG - Intergenic
1100457250 12:94764419-94764441 CAGTCAGCGTTCACCTACAATGG - Intergenic
1102723178 12:115035235-115035257 CATTCAGCAGACACATATAGAGG - Intergenic
1113878954 13:113612055-113612077 CACTGAGAGGTCACTTACAAGGG - Intronic
1120577605 14:86202951-86202973 CAGTCAGCAGTCACCAACAGAGG + Intergenic
1126363121 15:47866411-47866433 CATTCCGGGGTCATTTACAAAGG - Intergenic
1127455786 15:59155014-59155036 CATTCAGCTCTCACTCACTGAGG - Intronic
1127717584 15:61664629-61664651 CATTCAGTGGTCACTCTTAGAGG - Intergenic
1133894962 16:9918027-9918049 CATTCATAGATCACTTACTGTGG + Intronic
1134649993 16:15900739-15900761 CATTCTCAGGTCACTTTCAGAGG + Intergenic
1147637415 17:41972535-41972557 CATTCAGGGATCACTGTCAGTGG - Intronic
1154329732 18:13419960-13419982 CATTCTGCAGGCACTTTCAGGGG + Intronic
928767862 2:34670082-34670104 CATCCAGCCAGCACTTACAGAGG + Intergenic
932781032 2:74558594-74558616 CAGTCAGCCCTCACTCACAGAGG + Exonic
936686073 2:114827956-114827978 TATTCAGAGTACACTTACAGTGG + Intronic
938768013 2:134475770-134475792 TATGTAGTGGTCACTTACAGTGG - Intronic
942043332 2:172085128-172085150 CCTTCAGCGGTCCCTAACACCGG - Intronic
946883284 2:224197572-224197594 AATTCAGCCGAGACTTACAGGGG + Intergenic
948059165 2:235030936-235030958 CATTCAGGGGTGAGTAACAGAGG - Intronic
948119477 2:235518325-235518347 CATTCAGAGATCACTGTCAGTGG - Intronic
1169739966 20:8881480-8881502 CATTCACTGGTCACCTATAGAGG - Intronic
1173897004 20:46558842-46558864 CATTCAGCAGACACTTCCTGAGG + Exonic
1181639685 22:24190038-24190060 CATTCAGCGGGCACTGACCATGG + Intergenic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1185020302 22:48370600-48370622 CATTCATCTGTCACTCACGGAGG - Intergenic
1185210180 22:49566326-49566348 CATGCAGAAGTCACTCACAGGGG + Intronic
959031622 3:101306460-101306482 CATACAGCGGGCACTGACTGAGG + Intronic
975830610 4:78364273-78364295 CATACAGCTGGCATTTACAGAGG - Intronic
987240427 5:15992921-15992943 CATTGAGTGGTCCCTTACAGAGG + Intergenic
990149309 5:52799191-52799213 TATTCATCGGTCTCTTAAAGAGG + Intronic
995938376 5:117547086-117547108 CATTCAGTGTTCATATACAGTGG - Intergenic
999504933 5:152184820-152184842 CACTCAGAGGACATTTACAGTGG + Intergenic
1004727874 6:18328056-18328078 CATTCAGCTGTAAGTTACAATGG + Intergenic
1010438815 6:75868583-75868605 CATTCAGCTATCACTTTCAGTGG - Intronic
1012608157 6:101183737-101183759 TATTCAGGGGTCAGTTGCAGTGG + Intergenic
1023723129 7:43115105-43115127 CATTCTGTGGTAACTGACAGAGG + Intronic
1032602297 7:133310719-133310741 CATTTAGAGATCATTTACAGAGG - Intronic
1036132278 8:6126790-6126812 TTTTCTGCTGTCACTTACAGTGG + Intergenic
1044966907 8:97582624-97582646 CATTCAACTGACATTTACAGAGG + Intergenic
1047752938 8:127896168-127896190 CATTCAGCAGACATTTACTGAGG + Intergenic
1050224987 9:3443420-3443442 CATTCAGCTCCCACTTACAAGGG + Intronic
1052956685 9:34257812-34257834 ATTTCAGCAGTCACTCACAGTGG - Exonic
1059652485 9:116327736-116327758 CATTCAGCAGCCATTTACTGAGG - Intronic
1060469787 9:123938871-123938893 CATTCAGCAGACATTTCCAGTGG + Intergenic
1061855646 9:133440629-133440651 CATTCAGCGGTCACTTACAGGGG + Intronic
1197622576 X:128767225-128767247 CATTCAGCAGACATTTACTGAGG - Intergenic