ID: 1061857883

View in Genome Browser
Species Human (GRCh38)
Location 9:133452907-133452929
Sequence GGATATCCACAGAAGACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061857883_1061857887 5 Left 1061857883 9:133452907-133452929 CCTGATGTCTTCTGTGGATATCC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1061857887 9:133452935-133452957 GCCCTGGATATCCCTCCCCCAGG No data
1061857883_1061857890 10 Left 1061857883 9:133452907-133452929 CCTGATGTCTTCTGTGGATATCC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1061857890 9:133452940-133452962 GGATATCCCTCCCCCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061857883 Original CRISPR GGATATCCACAGAAGACATC AGG (reversed) Intronic
905664158 1:39752285-39752307 GGATATCCAGTGAAGACAACAGG - Intronic
906658460 1:47565731-47565753 GGATAGCCACAGATGGCATAAGG - Intergenic
909216030 1:72890932-72890954 GGATATCCACATATGAAATTGGG - Intergenic
916934611 1:169614649-169614671 GCATATCCACATATGACATATGG - Intronic
917860329 1:179137813-179137835 GGATTTCCACAGTGGACATAAGG + Intronic
918897264 1:190363847-190363869 GGACATCCAAAGTAGAAATCTGG - Intronic
922217152 1:223529274-223529296 GGAAATCCCCAGAAGACAGATGG + Intergenic
1063713483 10:8504304-8504326 GGCTATCAAAAGGAGACATCAGG - Intergenic
1064791780 10:18964825-18964847 TTATATGCACAGAAGACATTTGG + Intergenic
1066469205 10:35681747-35681769 GGAGACCCAAAGAAGACATTGGG + Intergenic
1071472419 10:85993113-85993135 GGCTATCCCCAGAGGACAACCGG + Intronic
1074641899 10:115394418-115394440 TTATATCCACAGTAGACTTCAGG + Intronic
1078548936 11:12267262-12267284 GGACATGCCCAGTAGACATCAGG - Intergenic
1080279113 11:30536063-30536085 GGATGTCCCCATAAGGCATCTGG + Exonic
1081561618 11:44222283-44222305 ATATATCCACAGCAGAGATCTGG + Intronic
1084434574 11:69131395-69131417 GGTTTTCCACAGAAGATGTCTGG + Intergenic
1088624005 11:111715656-111715678 TGAGATCCACAGATGACATGGGG + Intronic
1090928895 11:131277910-131277932 GGATATCAACAAAAGACACTAGG + Intergenic
1097566928 12:61281925-61281947 GGAAATACACAGAAAACATACGG - Intergenic
1098214448 12:68200618-68200640 TGACATCCCCAGAAGAGATCAGG + Intergenic
1101902892 12:108804428-108804450 GAATATCCATAGAAGGCAACTGG - Intronic
1103231089 12:119331033-119331055 GGATATCCACAGGAGCCAGGAGG + Intergenic
1104001196 12:124861730-124861752 GGATATCCACAGAAGGATGCTGG + Intronic
1107071546 13:36275501-36275523 GGCTGTCCACAGAACACCTCAGG + Intronic
1108440283 13:50446169-50446191 GGATATTCATGGAAGAGATCTGG - Intronic
1109095232 13:58106081-58106103 AGATATCCATAGAAGAAATCTGG - Intergenic
1110409225 13:75185513-75185535 GGAAAGTCACAGAAGAGATCTGG - Intergenic
1119003291 14:70902666-70902688 AGAGATCCACAGAAGAATTCTGG + Intergenic
1119567880 14:75644363-75644385 GGAAATACACAGTAGACATGAGG - Intronic
1119682284 14:76601835-76601857 GGAGATGCTCAGATGACATCAGG + Intergenic
1121225206 14:92316762-92316784 GGATAACCACAGGGGACAACAGG - Intergenic
1122909527 14:104820455-104820477 GGATACCCTCATAAGAGATCAGG - Intergenic
1124066769 15:26352175-26352197 GGACAGCCACAGAAGAGATCTGG - Intergenic
1133535460 16:6698253-6698275 AGATGTCCACAGAAGATATGGGG + Intronic
1134801887 16:17092063-17092085 GGGTATGAACAGAAAACATCTGG - Intergenic
1138292445 16:55859456-55859478 GCATTTCCACAGAAGACATCAGG - Intronic
1139969411 16:70764385-70764407 CGATATCCTCAGAAGACACCAGG - Intronic
1141093602 16:81147372-81147394 ATTTATCCACAGAACACATCAGG - Intergenic
1147789205 17:43002667-43002689 GGATATCCACAGAGTACCTGGGG - Exonic
1148286852 17:46400913-46400935 AAAAATCCACAGAAGTCATCTGG - Intergenic
1148309020 17:46618503-46618525 AAAAATCCACAGAAGTCATCTGG - Intronic
1151888828 17:76940290-76940312 GGATATTCACAGGAGGCAGCTGG - Intronic
1153226214 18:2901977-2901999 GGAGATCCACTGAGGATATCTGG + Intronic
1154971650 18:21415702-21415724 GGAAAACCACATAATACATCAGG + Intronic
1158259897 18:55595001-55595023 GGAGATCCAGAGAAGAAATGAGG - Intronic
1158818528 18:61131529-61131551 GGATGTGCACAGAGGACACCAGG - Intergenic
1163332161 19:16646643-16646665 GTGTTTCCACAGAAGACATGTGG - Exonic
1164247335 19:23443131-23443153 GGATGGCGACAGAAAACATCTGG + Intergenic
1168005124 19:53480711-53480733 AGATGTCCACAGATGACATAAGG - Intronic
928592808 2:32834689-32834711 GGCTTTCCACAGCAGACATGAGG - Intergenic
931630036 2:64290389-64290411 GCATATGCACAGATGACATGTGG + Intergenic
932322130 2:70830108-70830130 GGGTATCCTCAGGAAACATCTGG - Intergenic
936397912 2:112143062-112143084 GGATAGCCACAGAGGAGAGCAGG - Intronic
938224618 2:129605141-129605163 GGATGTCCACAGGAGAGAGCTGG - Intergenic
940360732 2:152793170-152793192 GGATCTCCTCAGATTACATCTGG + Intergenic
940475397 2:154155484-154155506 GTATGTGCACAGAAAACATCTGG - Intronic
942680589 2:178474521-178474543 GTATCTACACAGAATACATCTGG - Intronic
943799891 2:192044749-192044771 AGTTATCCACAGAAGATATCAGG - Intronic
944776922 2:202976145-202976167 TGATATCCACAGATGGCATATGG - Intronic
947097531 2:226582921-226582943 GGAAATCCAGAGAAGACAAAAGG - Intergenic
948964297 2:241364360-241364382 GGAAATCCACATAAGACCCCAGG + Intronic
1169321301 20:4635268-4635290 GGAAATCCACTGAAGACTTCGGG - Intergenic
1169865525 20:10195838-10195860 AGATATCCACTGAAGGCTTCAGG - Intergenic
1171091668 20:22291042-22291064 AGATTTCCACAGGAGACACCTGG - Intergenic
1171570853 20:26250581-26250603 GGATGTCCCCAGAACACAGCAGG - Intergenic
1172942063 20:38660848-38660870 GGGTTTCCACAGAAGTCATTGGG + Intergenic
1175583632 20:60120138-60120160 GGACATCCCCTGAAGCCATCAGG - Intergenic
1176310925 21:5148434-5148456 GGGTATCCACAGATGAGCTCTGG - Intronic
1177740503 21:25147960-25147982 GGAAATCCAGAGAATTCATCTGG - Intergenic
1179846130 21:44113601-44113623 GGGTATCCACAGATGAGCTCTGG + Intronic
1180573013 22:16747600-16747622 GGATGTCCCCAGAACACAGCAGG - Intergenic
1183330698 22:37219462-37219484 GGATATCCCTAGAAGGCTTCCGG - Intergenic
949448408 3:4161111-4161133 GGTAATCCACAGAACACTTCTGG - Intronic
951800858 3:26594833-26594855 GGTGATCCACAGAAGAATTCTGG + Intergenic
952782021 3:37110320-37110342 GTATGTCCTCAGATGACATCAGG - Intronic
953794804 3:45976386-45976408 GGACAGCCACAGAAGACACTTGG + Intronic
953838752 3:46371052-46371074 GGAAACCCATAGAAGACATTTGG + Intronic
953860203 3:46537790-46537812 GGATACCGACAGAAGACACGAGG + Intronic
955475636 3:59333365-59333387 GCATGTCCACAGGAGACTTCTGG + Intergenic
956974109 3:74560347-74560369 TCATATCCACAGATGACAGCTGG + Intergenic
958172667 3:89957640-89957662 GGATATTCACAGGAAACATGTGG - Intergenic
958620043 3:96546901-96546923 GGATATCAACAAAAGGCAACAGG + Intergenic
959355327 3:105320294-105320316 TGAAAGCCACATAAGACATCAGG - Intergenic
961329252 3:126129112-126129134 GGGTCCCCACAGAGGACATCGGG - Intronic
965196804 3:165608852-165608874 GGATATCCACAGAAAATTTCTGG + Intergenic
967349950 3:188503117-188503139 GAATATACACAAAAGAAATCAGG - Intronic
970429037 4:15971791-15971813 GGACATGCACGGAGGACATCAGG + Intronic
972431651 4:38988797-38988819 TGAAATCCATAGAAGAGATCAGG + Intronic
972821713 4:42709231-42709253 GAATATCCTGAGAAGACATAGGG + Intergenic
973606392 4:52591692-52591714 GGATTTGAACAAAAGACATCAGG - Exonic
975074388 4:70186770-70186792 GGGTATCCACAGAATACCTGTGG - Intergenic
977032296 4:91900714-91900736 GGAGGTCCACAGAAGCCATCAGG - Intergenic
978254580 4:106679142-106679164 GAATATTCACAGAAGAAATGAGG - Intergenic
981910918 4:149980938-149980960 GAATATTAACAGAAGGCATCAGG + Intergenic
982853686 4:160353536-160353558 GAATATCCCCAAAAGAAATCTGG + Intergenic
983590956 4:169410836-169410858 CCCTATCCACAGAACACATCTGG + Intronic
984133709 4:175910241-175910263 GAATAGCCAGAGAAGACATATGG - Intronic
989403923 5:41039375-41039397 GGATATTCACTGAAGAAATCAGG + Intronic
989669550 5:43899486-43899508 GGATCTCAACAGAAGACAGATGG + Intergenic
993317549 5:86429638-86429660 GGAGATCAAAAGAAAACATCAGG - Intergenic
993842011 5:92891549-92891571 GGATATGCAGAGAAGGAATCAGG - Intergenic
995096433 5:108240592-108240614 GCACATCCAGAGATGACATCTGG - Intronic
995858116 5:116614975-116614997 GGATGTCCAGATAAGACATCAGG + Intergenic
1001182580 5:169534321-169534343 GGATATGCAAGGAGGACATCAGG - Intergenic
1004158772 6:13194924-13194946 TGAAAACCACAGCAGACATCTGG - Intronic
1007914791 6:45551464-45551486 GGCTATCAACAGAAGATCTCAGG + Intronic
1015223400 6:130830086-130830108 AGAAAACCACAGAAGGCATCTGG + Intronic
1017963669 6:159245335-159245357 GCTGATACACAGAAGACATCTGG + Intronic
1018274037 6:162111052-162111074 AGATGTCCACAGAAGACGTTCGG + Intronic
1019296633 7:280371-280393 AGACATCCACAGAACACGTCTGG + Intergenic
1021883255 7:25113919-25113941 GGATATCTACAAAAGGAATCTGG + Intergenic
1023754261 7:43401594-43401616 ATATAGCCACAGTAGACATCTGG + Intronic
1025811757 7:64880157-64880179 GGATCCCCAGAGAAGACAACCGG - Intronic
1029048348 7:97655951-97655973 GGACATCCAAAGAATACATTTGG - Intergenic
1032202752 7:129834389-129834411 GTAACTCCACAGAAGACATAGGG + Exonic
1032788380 7:135220296-135220318 AGATCTCCACAGGGGACATCTGG + Intergenic
1035079518 7:156204297-156204319 GGATTTCCACAGAAAAGACCTGG - Intergenic
1035331019 7:158097518-158097540 GGAGCTCCACCGAAGCCATCTGG + Intronic
1035921141 8:3677476-3677498 TGAGCACCACAGAAGACATCAGG + Intronic
1043540390 8:81255756-81255778 GTAACTCCACAGAAGACATAGGG - Intergenic
1046613843 8:116454406-116454428 GGAGATCCAAAGAAAACACCAGG + Intergenic
1047336508 8:123941596-123941618 ACATATCAACAGAAGTCATCTGG - Intronic
1049059173 8:140262937-140262959 GGGGATGCACAGAGGACATCTGG + Intronic
1052164940 9:25314243-25314265 TGCTATTCACAGAAGACATGAGG + Intergenic
1053078687 9:35156139-35156161 GGAGATCCACCTAAGACCTCGGG - Intergenic
1057710028 9:97431929-97431951 AGACACCCACAGAAAACATCTGG + Intronic
1058868952 9:109186135-109186157 GGATATCAACAGAGGGCACCAGG + Intronic
1059383989 9:113949950-113949972 GGATAATCACAGAAGAGATGAGG - Intronic
1059860452 9:118454828-118454850 AGATATCCATAGAAGAAAACAGG - Intergenic
1061857883 9:133452907-133452929 GGATATCCACAGAAGACATCAGG - Intronic
1189939849 X:46110295-46110317 GGATATCCCCACAAGATATCTGG + Intergenic
1190176293 X:48153119-48153141 TGACATCCATAGAATACATCTGG + Intergenic
1191780468 X:64858705-64858727 GGATACCCAAAGAAACCATCGGG + Intergenic
1193473017 X:81929411-81929433 GGATATTTACAGAAGTAATCAGG - Intergenic
1194470849 X:94294577-94294599 GGATGTGCACAGAAGTCATATGG + Intergenic
1195304757 X:103570595-103570617 GGATATCCCCAGACAGCATCAGG + Intergenic
1195594199 X:106669273-106669295 GCATATCCACAGGACACAACTGG + Exonic
1196861369 X:120031500-120031522 GCAATTCCACAGATGACATCAGG + Intergenic
1197703523 X:129617319-129617341 GTATATCCACAGGAGCCAACAGG - Intergenic