ID: 1061857887

View in Genome Browser
Species Human (GRCh38)
Location 9:133452935-133452957
Sequence GCCCTGGATATCCCTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061857883_1061857887 5 Left 1061857883 9:133452907-133452929 CCTGATGTCTTCTGTGGATATCC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1061857887 9:133452935-133452957 GCCCTGGATATCCCTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061857887 Original CRISPR GCCCTGGATATCCCTCCCCC AGG Intronic
No off target data available for this crispr