ID: 1061859535

View in Genome Browser
Species Human (GRCh38)
Location 9:133460761-133460783
Sequence GCTCACTGCCCCGCGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061859535_1061859540 -1 Left 1061859535 9:133460761-133460783 CCTGGGGCCGCGGGGCAGTGAGC 0: 1
1: 0
2: 0
3: 18
4: 350
Right 1061859540 9:133460783-133460805 CTGAGGGCCCGGCCTCTCCCTGG No data
1061859535_1061859541 0 Left 1061859535 9:133460761-133460783 CCTGGGGCCGCGGGGCAGTGAGC 0: 1
1: 0
2: 0
3: 18
4: 350
Right 1061859541 9:133460784-133460806 TGAGGGCCCGGCCTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061859535 Original CRISPR GCTCACTGCCCCGCGGCCCC AGG (reversed) Intronic
900134470 1:1109360-1109382 CCTCCCTGCCCCCCAGCCCCTGG - Intronic
900408227 1:2501718-2501740 GCTCAGAGGCCCGCAGCCCCCGG - Intronic
900659955 1:3777334-3777356 GCACACTGCCCCAAGGCTCCTGG + Intergenic
900980146 1:6041612-6041634 GGTCTCTGCCCCGTGGCCACCGG + Intronic
901763981 1:11488367-11488389 GCTCAGTACCCCTCAGCCCCTGG - Intronic
902584985 1:17433413-17433435 CCGCCCTGCCCCGCCGCCCCGGG - Intronic
902598878 1:17527469-17527491 GCTCCCTGCCCTGTGGCTCCAGG - Intergenic
902696547 1:18144313-18144335 CCTCCATGCCCCGCTGCCCCAGG + Intronic
903263303 1:22142757-22142779 GCCCGCTGCCCCGCGCCGCCTGG + Intronic
904023922 1:27490199-27490221 GCTCACTGCCCCACCCACCCGGG + Intergenic
904376000 1:30082882-30082904 GGTCACTGCAGGGCGGCCCCAGG + Intergenic
905257150 1:36692172-36692194 GTTCTCTGCCCCGGGGTCCCAGG + Intergenic
906128751 1:43443330-43443352 GCTCACTGCCCTGTTTCCCCAGG + Exonic
906640517 1:47438260-47438282 GCTCCGGGCCCCGCGCCCCCCGG + Exonic
906877663 1:49556739-49556761 GCCCCCTGCTCCGAGGCCCCAGG - Intronic
912532739 1:110338461-110338483 ACTCTCTGCCCCGCGGGCCCAGG + Intergenic
913534207 1:119755631-119755653 GCTCCCTGCCTCCCGTCCCCTGG - Intronic
914428619 1:147600248-147600270 GCTCTCAGCCCCGCGGGGCCGGG - Intronic
914531383 1:148526225-148526247 GCTCACTGCACCTCCGCCTCCGG - Intergenic
919694878 1:200564185-200564207 GCTCACTGCCCCTCTGCTCCTGG - Intronic
920001951 1:202807067-202807089 ACTCACTGCCCCCAGGCCCGAGG + Intronic
920090113 1:203446688-203446710 GCAAACTGCCCCCAGGCCCCAGG - Intergenic
920349681 1:205329583-205329605 GCTGGCTGCCCCGAGGCACCGGG + Intergenic
922832413 1:228610465-228610487 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922832973 1:228612706-228612728 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922833534 1:228614947-228614969 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922834094 1:228617188-228617210 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922834651 1:228619429-228619451 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922835203 1:228621644-228621666 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922835762 1:228623864-228623886 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922836320 1:228626106-228626128 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922836878 1:228628345-228628367 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922837437 1:228630587-228630609 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922837998 1:228632828-228632850 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922838556 1:228635068-228635090 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922839114 1:228637293-228637315 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922839674 1:228639534-228639556 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922840235 1:228641765-228641787 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922840795 1:228644006-228644028 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
922841358 1:228646237-228646259 GATCCGAGCCCCGCGGCCCCGGG - Intergenic
1062799298 10:367941-367963 TCTCACTGCCGCACAGCCCCAGG + Intronic
1063148897 10:3319845-3319867 GCCCACTGCTCCACGGCGCCCGG - Intergenic
1063339960 10:5253651-5253673 GCTCACTGCCCCTCACTCCCAGG - Intergenic
1063343776 10:5293000-5293022 GCTCACTGCCCCTCACTCCCAGG + Intergenic
1063371914 10:5527650-5527672 GCTCACAGCCCCCCACCCCCTGG - Intergenic
1064194640 10:13234884-13234906 GCTCTGGGACCCGCGGCCCCAGG - Intergenic
1064380707 10:14838806-14838828 GCTCGCAGCCCCGCCGTCCCCGG - Intronic
1065101608 10:22336581-22336603 GCGCGCAGCCCCGCAGCCCCTGG - Intergenic
1065786490 10:29220478-29220500 GCTCACTGCTCTCCAGCCCCCGG + Intergenic
1067061379 10:43079675-43079697 CCTCTCTGCCCCTGGGCCCCGGG + Intronic
1067066027 10:43104836-43104858 GCGCACACCGCCGCGGCCCCAGG - Intronic
1068545019 10:58335244-58335266 GGCCGCTGCCCCGCAGCCCCAGG - Intronic
1071603049 10:86968339-86968361 GCTCCCTGCCCTGCGGACTCTGG + Exonic
1073136754 10:101224574-101224596 GCTCTCTGCTTCGCGGCCCTGGG - Intergenic
1073249823 10:102114639-102114661 GCCCCCTGGCCCCCGGCCCCCGG - Intronic
1075911759 10:126131178-126131200 GCTCCCTGCCTCGGGGACCCTGG + Intronic
1076417895 10:130304594-130304616 GCCCACTGCTCCAAGGCCCCAGG - Intergenic
1076721658 10:132395955-132395977 TCCCACTGCCGCGCGGCCGCCGG + Intergenic
1077038360 11:506476-506498 GCTCTCCTCCCCGCAGCCCCAGG + Intronic
1077043123 11:533246-533268 CCTCACTGCCCTGCCGTCCCGGG + Intronic
1077160216 11:1109265-1109287 GCTCCCTGCCCCACAGCCCGGGG + Intergenic
1077488855 11:2851301-2851323 GCTCCCTGCCCCTCGGTGCCAGG + Intergenic
1079091928 11:17486821-17486843 TCTCCCCGCCCCGCGGCCCCTGG - Intergenic
1079107404 11:17580223-17580245 CCTCACTGCCTAGTGGCCCCAGG - Intronic
1079159459 11:17978601-17978623 GCTCACTGGCCCTTGTCCCCTGG + Intronic
1081670471 11:44939504-44939526 TCTCAGTGCCCTGTGGCCCCAGG + Intronic
1081794818 11:45811909-45811931 GGCCACTGCCCAGCAGCCCCTGG - Exonic
1081869207 11:46375716-46375738 GCTGACTGTCCCTCTGCCCCAGG + Intronic
1083618446 11:64037326-64037348 GCTGCCTCCCCCGCGGCCGCCGG - Intronic
1084266705 11:68008755-68008777 GCTCCCGGCCCCGGGGCCTCTGG - Intronic
1084544818 11:69810006-69810028 CCACACTGCCCCGCTGCTCCTGG + Intergenic
1085274503 11:75289675-75289697 ACTCACTCCCCCACGGCCCTCGG + Intronic
1089776034 11:120836675-120836697 GCCCACTGCCCCTTGGCACCAGG - Intronic
1089981893 11:122779565-122779587 GTTCTCGGCCCCGCTGCCCCTGG + Exonic
1090581867 11:128169281-128169303 GCTCACTGCCCCGTGCACCCCGG + Intergenic
1092290978 12:7159278-7159300 GCTCCCTGCTGGGCGGCCCCAGG + Intergenic
1096493017 12:52023309-52023331 ACCCACAGCCTCGCGGCCCCGGG - Intronic
1096495487 12:52037229-52037251 GCTCAGCGCCCCCCGCCCCCGGG - Intronic
1096500611 12:52062098-52062120 GCCCAGTGCCCAGAGGCCCCTGG + Intergenic
1100599072 12:96097492-96097514 GCTCACTGCACCTCCGCCTCCGG + Intergenic
1101874420 12:108589289-108589311 GCCCACTGCCCCCCAGCCCCAGG + Intergenic
1102973560 12:117190164-117190186 GCCCACCGCCCCGCGCCCCCCGG - Intronic
1103725509 12:122995680-122995702 GCTCACTGCCAGGTGGCCGCTGG + Intronic
1103895341 12:124269442-124269464 GAACACAGCCCCGCGGCGCCTGG + Intronic
1104448900 12:128853713-128853735 GCTGAGCGCCCCGCGTCCCCGGG - Intronic
1104979853 12:132568976-132568998 GCTCACTGTCCCAAGGCCTCAGG + Intronic
1106087103 13:26553124-26553146 TCTCACTGCCCTGTGGGCCCCGG + Intergenic
1106099587 13:26682796-26682818 GGTCACAGCCCCGCCACCCCCGG + Exonic
1108594255 13:51936431-51936453 GCTCCCTGCCCCCTGCCCCCAGG - Intronic
1110318518 13:74135318-74135340 ACTCCCTTCCCCGCCGCCCCCGG - Intergenic
1111220972 13:85205254-85205276 GCCCCCTGCTCCGCGGCTCCAGG + Intergenic
1112091769 13:96090696-96090718 GCTGGCGGCCCCGCGGCCCTCGG - Intergenic
1112226557 13:97545614-97545636 GCTCCCTGCTCCACGGCGCCCGG + Intergenic
1113657684 13:112078504-112078526 GCTCCCTGGCCCGCAGTCCCAGG - Intergenic
1116887145 14:50232040-50232062 GCGGACTCCCCCGGGGCCCCAGG - Intergenic
1117072578 14:52069534-52069556 GCTCCCTGCCCTGGGGTCCCGGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122141246 14:99664240-99664262 GCTCAGTGCCCAGAGCCCCCAGG + Intronic
1122283589 14:100638403-100638425 CCTCAGTGCCCCGGAGCCCCGGG + Intergenic
1122694179 14:103544869-103544891 GCGCACTGGCCTGGGGCCCCTGG - Intergenic
1122879437 14:104683444-104683466 CCTCCCTGCCCCACGGCTCCAGG - Intergenic
1122894778 14:104751555-104751577 GCCCCCTGCTCCGCGGCACCCGG - Intergenic
1122987228 14:105218076-105218098 GCTCAGGGCCCTGCTGCCCCTGG + Intronic
1123008545 14:105336028-105336050 GCTCCGTGCCCTGCTGCCCCTGG - Intronic
1123500446 15:20877297-20877319 GCTCTCGGACCTGCGGCCCCTGG + Intergenic
1123557691 15:21450990-21451012 GCTCTCGGACCTGCGGCCCCTGG + Intergenic
1123593918 15:21888271-21888293 GCTCTCGGACCTGCGGCCCCTGG + Intergenic
1124166173 15:27327784-27327806 TCTCACTGCCCCGGGGCACAGGG + Intronic
1127763473 15:62164087-62164109 GCGCAGTGCCCGGCGGCCGCAGG + Exonic
1129067391 15:72917056-72917078 GCTCAATGCCCTGTGGCCACAGG + Intergenic
1129523725 15:76201238-76201260 CCTCACTGCCTCGCTGCCCTTGG + Intronic
1129711041 15:77820277-77820299 GGTCCCTTCCCCGGGGCCCCCGG - Intronic
1129761301 15:78130791-78130813 GCTCCCTGCCCCCCAGCCCCAGG - Intronic
1130259934 15:82346796-82346818 GGTCACTGCACCTCGGCCCAGGG + Intronic
1130268791 15:82432640-82432662 GGTCACTGCACCTCGGCCCAGGG - Intronic
1130281295 15:82522213-82522235 GGTCACTGCACCTCGGCCCAGGG - Intergenic
1130398684 15:83529350-83529372 ACACACTGCCCAGGGGCCCCAGG - Intronic
1130472670 15:84238396-84238418 GGTCACTGCACCTCGGCCCAGGG - Intronic
1130480161 15:84352967-84352989 GGTCACTGCACCTCGGCCCAGGG - Intergenic
1130484391 15:84390538-84390560 GGTCACTGCACCTCGGCCCAGGG - Intergenic
1130491608 15:84435162-84435184 GGTCACTGCACCTCGGCCCAGGG + Intergenic
1130503223 15:84514202-84514224 GGTCACTGCACCTCGGCCCAGGG + Intergenic
1130910671 15:88268721-88268743 GCTCACTGCCCACCGACACCTGG - Intergenic
1131373816 15:91907277-91907299 GCTCACTGCACCTCTGCCACTGG + Intronic
1132065494 15:98727661-98727683 GCTCTCTGCCCTCCAGCCCCTGG - Intronic
1132231030 15:100184385-100184407 GCTCACTGGCCAGGGGCCCCAGG - Intronic
1132333653 15:101029392-101029414 GCTCACTGTCCTGCTGACCCAGG - Intronic
1202966043 15_KI270727v1_random:178162-178184 GCTCTCGGACCTGCGGCCCCTGG + Intergenic
1132466135 16:78166-78188 GCTCACTGCCCCCCTTCTCCCGG + Intronic
1132513044 16:353398-353420 GCTCCCTGCCCAGCCGGCCCTGG + Intergenic
1132551647 16:556196-556218 GCTGACTGGGCCGCGGCTCCAGG + Intergenic
1132696832 16:1205756-1205778 GCTCACTCCCTCCCCGCCCCAGG - Intronic
1133784593 16:8964115-8964137 GCTCCCTGCCCCCGGGCCCTGGG + Intronic
1135015999 16:18925866-18925888 CCTCCCAGCCCCGCGGCCCTAGG + Intronic
1135321620 16:21501693-21501715 CCTCCCAGCCCCGCGGCCCTAGG + Intergenic
1135470174 16:22723027-22723049 GCTCCCTGCTCCACGGCACCCGG - Intergenic
1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG + Exonic
1135615904 16:23910831-23910853 TCTCTCTTCCCTGCGGCCCCTGG + Intronic
1136333095 16:29594803-29594825 CCTCCCAGCCCCGCGGCCCTAGG + Intergenic
1136447791 16:30334891-30334913 CCTCCCAGCCCCGCGGCCCTAGG + Intergenic
1136455642 16:30378345-30378367 CCACACTGCCCAGCGCCCCCCGG - Exonic
1136620989 16:31428182-31428204 GTTCACAGGCCCGCCGCCCCAGG - Intronic
1136737637 16:32477762-32477784 GCACTCTGCCCTGCTGCCCCTGG + Intergenic
1138557854 16:57783274-57783296 GCTCCTTGCCCCACAGCCCCTGG - Intronic
1141395918 16:83704558-83704580 GCCCACAGCCCCGCTGCCACAGG + Intronic
1141762553 16:86038442-86038464 GCTCCCTGCAGAGCGGCCCCCGG + Intergenic
1142017032 16:87754894-87754916 GCTCACTCCCCCTAGGCCCACGG - Intronic
1142037164 16:87869452-87869474 GCTCGCTGGGCCGCGGCTCCCGG - Exonic
1142215513 16:88827837-88827859 GGTCCCTGCCCAGCTGCCCCAGG - Intronic
1203015434 16_KI270728v1_random:351815-351837 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1203033769 16_KI270728v1_random:624973-624995 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1142812288 17:2401002-2401024 GCCTCCCGCCCCGCGGCCCCCGG + Exonic
1143134498 17:4704028-4704050 GCTCACTGCCGAGAGACCCCCGG + Exonic
1143408720 17:6695908-6695930 GCTCTCTAGCCCGCAGCCCCAGG + Exonic
1143544777 17:7589552-7589574 GCTGGGAGCCCCGCGGCCCCCGG - Exonic
1145272282 17:21411163-21411185 GCCCACTGCCCTGAGGCCCTGGG - Intronic
1145310487 17:21698628-21698650 GCCCACTGCCCTGAGGCCCTGGG - Intronic
1145979930 17:29005438-29005460 ACTCACTGCCTTGCGCCCCCCGG + Intronic
1146058691 17:29593534-29593556 GCCCCCCGCCCCGCGGCCCCGGG + Exonic
1146884061 17:36459306-36459328 TCTCACTGCCCTGCCACCCCAGG + Intergenic
1147187776 17:38722043-38722065 GCCCCCAGCCCCGCTGCCCCGGG - Exonic
1147879776 17:43646155-43646177 GCTGCCTGCCCGGCGGCCTCTGG + Intronic
1147924609 17:43938740-43938762 GCCCCCAGCCCCGAGGCCCCTGG - Exonic
1150645964 17:66977640-66977662 GCTCCCTGCCCCGTGGTGCCTGG - Intronic
1151431652 17:74067638-74067660 GCTCACTGACCCCCAGCCTCAGG + Intergenic
1151782691 17:76257910-76257932 GCTCATTGCCCTGCCGGCCCGGG - Intergenic
1152245984 17:79184784-79184806 CCCCACTGCCAGGCGGCCCCAGG - Intronic
1152263184 17:79278232-79278254 GCTCCCTGGCCCGTGGCTCCAGG + Intronic
1152360781 17:79832205-79832227 GCCCCCAGCCCCGCGGTCCCTGG + Intergenic
1152534244 17:80941243-80941265 GCTCCCTGCCCCTCCACCCCGGG - Intronic
1152551955 17:81034633-81034655 GCTCCCCGCCCCGCAGCGCCAGG + Intergenic
1152834408 17:82519947-82519969 GCCCCCGGCCCCGCCGCCCCCGG - Exonic
1152862906 17:82706002-82706024 GGTCACTACCCGTCGGCCCCAGG - Intergenic
1157856860 18:51111874-51111896 GCCCCCTGCTCCACGGCCCCTGG - Intergenic
1158893667 18:61894538-61894560 GCCCACAGCCCGGCGGGCCCGGG + Intergenic
1160486827 18:79300588-79300610 GTCCACGGCCCCGCAGCCCCGGG - Intronic
1160695753 19:483554-483576 GGACACTGCCCAGCGTCCCCTGG - Intergenic
1160725549 19:616480-616502 GCCGACCGCCCCGCGGGCCCAGG + Exonic
1160795333 19:942656-942678 TCCCACTGCCCCGCAGGCCCTGG + Intronic
1160932650 19:1577984-1578006 GCTGTGTGCCCCGAGGCCCCGGG + Exonic
1160983709 19:1827990-1828012 GCTCACTGCCGCGGGAGCCCCGG + Exonic
1161163747 19:2774395-2774417 GCTCACTGTGCTGCGGTCCCAGG + Intronic
1161234719 19:3192231-3192253 GCTCAGTGCCACGCGAACCCTGG - Intronic
1161767764 19:6216513-6216535 CCTCCCTGCCCCGCCTCCCCAGG - Exonic
1162018115 19:7856560-7856582 GCTCACTGAGCCCCAGCCCCGGG + Intronic
1162124220 19:8490565-8490587 GCGCCCGGCCCCGCAGCCCCGGG - Intronic
1162987148 19:14277936-14277958 GCCCCCTGCTCCGCGGCGCCGGG + Intergenic
1163551175 19:17967167-17967189 GCCCCCGGCCCCGCCGCCCCCGG + Intronic
1163991058 19:20999824-20999846 GCTCCCGGCCCCGCGCCCTCGGG - Intergenic
1164809837 19:31147298-31147320 CCTCACTGACCCTCAGCCCCTGG - Intergenic
1165129170 19:33621693-33621715 GCTCCCACCCCCGCGGCCGCCGG + Intergenic
1165389732 19:35531497-35531519 GCTCCCTCCCCTGCAGCCCCGGG - Intergenic
1165461046 19:35944650-35944672 GCTCACGGCCACGCGGCCTGTGG + Exonic
1166054558 19:40280596-40280618 CCTGCCTGCCCCGCAGCCCCAGG + Intronic
1167246449 19:48375951-48375973 GCTCACTGCCCAGGAGCCCTAGG - Intronic
1168125194 19:54278947-54278969 GCTCCCTGGCCGGCAGCCCCAGG - Exonic
1168172060 19:54595778-54595800 GCTCCCTGGCCCACAGCCCCAGG + Exonic
1168307219 19:55442324-55442346 GCCCTCGCCCCCGCGGCCCCCGG + Exonic
1168308973 19:55451412-55451434 TCTCCCCGCCCCGCCGCCCCTGG - Intergenic
1168315702 19:55483893-55483915 GCTCACTGGCCCGGGCCCCGGGG + Exonic
925120515 2:1415078-1415100 GCACACAGTCCCGGGGCCCCTGG + Intronic
925120555 2:1415200-1415222 GCACACAGTCCCGGGGCCCCTGG + Intronic
925120595 2:1415322-1415344 GCACACAGTCCCGGGGCCCCTGG + Intronic
925120632 2:1415444-1415466 GCACACAGTCCCGGGGCCCCTGG + Intronic
928166513 2:28976491-28976513 GCTCCCTGCCCCACAGCCACAGG - Intronic
929425580 2:41841291-41841313 GCTCCCTGGCCCGATGCCCCCGG + Intergenic
932087531 2:68775169-68775191 GCTCACTGCCCCATGTCCCTCGG + Intronic
933415873 2:81985487-81985509 GCTCCCTGCTCCACGGCACCCGG + Intergenic
933924067 2:87076298-87076320 GCACTCGGCCCCGCGTCCCCAGG + Intergenic
934188761 2:89766875-89766897 GCACTCTGCCCTGCTGCCCCTGG + Intergenic
934307831 2:91841078-91841100 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
934780838 2:96968672-96968694 GCTCACAGCCAGGAGGCCCCTGG - Intronic
935866484 2:107392615-107392637 GCCCCCTGCTCCGCGGCACCCGG + Intergenic
937914576 2:127092620-127092642 TCCCACTGACCCGCAGCCCCGGG + Intronic
937924536 2:127157737-127157759 TCTCACTGCCCTCCAGCCCCGGG - Intergenic
938201636 2:129377236-129377258 CCTCACAGCCCCACAGCCCCAGG - Intergenic
938288197 2:130135977-130135999 GCCCACTGCCCCACTGCCCCCGG + Intergenic
938427387 2:131202919-131202941 GCCCACTCCCCCACTGCCCCCGG - Intronic
938468333 2:131536967-131536989 GCCCACTCCCCCACTGCCCCCGG - Intergenic
939869045 2:147507015-147507037 CCTCACTGCCCCGGCGCCCGCGG - Intergenic
941903179 2:170696945-170696967 GCTCGCTGCCCCACATCCCCAGG + Intergenic
941911865 2:170771345-170771367 CCTCCCTTCCCGGCGGCCCCTGG - Intergenic
942062413 2:172240046-172240068 GCTCACTGCCACTTGGCCCAAGG + Intergenic
942451086 2:176108168-176108190 CCCCCCTCCCCCGCGGCCCCCGG - Intronic
945151622 2:206797562-206797584 GCTCTTTGCCCAGCTGCCCCAGG + Intergenic
946418101 2:219550665-219550687 GCTCACTGCACAGGGGCTCCAGG + Intergenic
947426126 2:229984461-229984483 GCTCACTGCAACGCCGCTCCCGG + Intronic
948383393 2:237566930-237566952 GCACTCTGCCCCGCTGCCTCTGG + Intronic
948809199 2:240466286-240466308 GGTAACTGCCCCAAGGCCCCAGG + Exonic
1168830107 20:841214-841236 GTTCACTTGCCCGCGGCCGCCGG + Intronic
1170557951 20:17530885-17530907 GCTCCCAGCCCCGCGCCGCCGGG + Intronic
1170898632 20:20438604-20438626 GCGCACTGCCTGGCAGCCCCGGG - Intronic
1171896422 20:30813916-30813938 GATCCCAGCCTCGCGGCCCCGGG - Intergenic
1172019851 20:31906404-31906426 CCTCACGGCCCCGCAGCCTCTGG + Intronic
1173822698 20:46029409-46029431 GCCCCCTCCCCCGCCGCCCCCGG - Intronic
1174420333 20:50395374-50395396 GCTCACTCCCACAAGGCCCCGGG + Intergenic
1174421814 20:50404142-50404164 GCTCTCTGCCCACCGGCCCAGGG + Intergenic
1175268229 20:57715256-57715278 GCACAGGGCCCAGCGGCCCCTGG + Intergenic
1175793566 20:61757490-61757512 GCTGACTGCCCCTGGGGCCCTGG - Intronic
1175829585 20:61954813-61954835 GCTCTCTGCCCCGCGCCACCAGG - Intronic
1175934303 20:62508053-62508075 GCTCCCTGCCCCAGGGGCCCTGG + Intergenic
1178261191 21:31101122-31101144 CCTCACTGCCCCACCACCCCAGG - Intergenic
1178487451 21:33027871-33027893 CCTCGCTTCCCCGCGGCCCCTGG - Exonic
1178851135 21:36213327-36213349 GCTCACTTACTTGCGGCCCCAGG + Intronic
1179553924 21:42160493-42160515 AGTTACTGCCCCGCGGCTCCAGG - Intergenic
1179779336 21:43689434-43689456 GCTCAGTGCACTGCTGCCCCTGG - Intronic
1179945506 21:44671300-44671322 GCACACTGCCCAGCGGCCCAAGG + Intronic
1180534917 22:16388160-16388182 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1180998758 22:19978240-19978262 GCTAACTGCCCCCAGGCCTCAGG + Intronic
1181051916 22:20241929-20241951 GCTCACTGCAGTGCGGCCCGAGG - Exonic
1181107742 22:20584854-20584876 GCCCACTCCCCCACCGCCCCCGG + Exonic
1181538303 22:23558597-23558619 GCTCACTGCACCTCAGCCTCTGG - Intergenic
1181669051 22:24417465-24417487 GCTCACTGTCCCACAGCCCCAGG - Exonic
1183195449 22:36350868-36350890 GCTCACTGCCCAGCTCCCGCTGG + Intronic
1184597218 22:45521498-45521520 CGTCACTGCCCTGTGGCCCCAGG + Intronic
1184856484 22:47149252-47149274 GCTCACGGCCCGGCGGCGGCAGG + Intronic
1185052861 22:48562900-48562922 TCTCACAGCCCCGGGACCCCGGG + Intronic
1185066577 22:48635305-48635327 GCTGCCTGCCCCCAGGCCCCTGG - Intronic
1185340314 22:50288037-50288059 ACTCACGGCCCCGCTGCCCTAGG - Exonic
951323151 3:21271651-21271673 GCCCCCTGCTCCGCGGCACCTGG - Intergenic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
954289144 3:49640008-49640030 GCTCTCTGCCTTGAGGCCCCAGG - Intronic
954695916 3:52426027-52426049 GCTCACTGCCCCGACCTCCCTGG + Intergenic
956420213 3:69079951-69079973 GATCCCCGCCCCGCAGCCCCGGG - Intronic
957085439 3:75672454-75672476 GATCCCAGCCTCGCGGCCCCGGG - Intergenic
966217286 3:177516852-177516874 GCCCACTGACCTGCAGCCCCAGG - Intergenic
966911462 3:184562391-184562413 GCCCGCAGCCCCGCGACCCCAGG - Intronic
968235796 3:197029539-197029561 TCTCACTGCCCCGGAGCCGCAGG + Intronic
968533904 4:1112361-1112383 GCTCACAGCCCTCCAGCCCCAGG - Intronic
968583534 4:1405731-1405753 CCTCACAGCCCTGCAGCCCCTGG + Intronic
968583872 4:1406988-1407010 GCTCGCTGGCCCGCGCGCCCTGG - Intergenic
968905392 4:3448397-3448419 GCTCCCTGCCCAGGGGTCCCTGG - Intronic
969299553 4:6289711-6289733 GCACACTGCCCCACGGCACCAGG - Intronic
969559538 4:7938855-7938877 GGTGACAGCCCCGCGCCCCCCGG + Intronic
969703544 4:8780431-8780453 GCTGACTACCCCACGCCCCCAGG - Intergenic
972637820 4:40899863-40899885 GCTCACTGGCTCCTGGCCCCTGG - Intronic
973830708 4:54756170-54756192 TCTCTCTGCCCCACTGCCCCTGG + Intergenic
978030650 4:103937125-103937147 GCTCCCTGCTCCACGGCACCTGG + Intergenic
979033176 4:115678531-115678553 GCTCCCTGCTCTGCGGCGCCCGG - Intergenic
981033693 4:140151073-140151095 CCTCCCAGCCCAGCGGCCCCGGG + Intronic
981280647 4:142954591-142954613 ACCCCCTGCTCCGCGGCCCCTGG + Intergenic
985445515 4:190019243-190019265 GATCCCAGCCTCGCGGCCCCGGG + Intergenic
985512605 5:321061-321083 GCTCTCGGCCGCGCGGTCCCGGG + Intronic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987374030 5:17217877-17217899 GCGCCCCGCCCCGCAGCCCCCGG + Intronic
990545610 5:56817045-56817067 GCCCACCGCACTGCGGCCCCTGG - Intronic
992039486 5:72816345-72816367 GCTCACAGCCCCACCGCGCCGGG + Exonic
995991795 5:118248069-118248091 GCTCACTGCCCAGGAGCCCAAGG + Intergenic
996378967 5:122845268-122845290 GCTCCCTGCCCTGCGGACTCCGG - Intronic
996862549 5:128083306-128083328 GTCCACTGACGCGCGGCCCCTGG + Intergenic
1002517994 5:179773760-179773782 GCTTTCTGCCCCATGGCCCCCGG + Intronic
1002612833 5:180432496-180432518 GCCCCCTGCTCCGCGGCGCCTGG + Intergenic
1002665011 5:180816728-180816750 GCTCAATGCCCAGCAGCGCCAGG - Intergenic
1003061848 6:2870098-2870120 GCCCACTGCTCCGCGGCGCCTGG - Intergenic
1003099033 6:3163113-3163135 TCCCCCTGCGCCGCGGCCCCTGG - Intergenic
1003532919 6:6952663-6952685 GCCTACTGCTCCGCGGCGCCCGG + Intergenic
1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG + Exonic
1004044567 6:12012079-12012101 GCCCCGGGCCCCGCGGCCCCAGG + Intronic
1004483195 6:16040419-16040441 GCCCCCTGCTCCGCGGCACCCGG - Intergenic
1005751256 6:28885164-28885186 GCCCCCTGCTCCGCGGCGCCCGG - Intergenic
1006520545 6:34568653-34568675 GCTCAGTGTCCCCCAGCCCCAGG - Intergenic
1007614484 6:43172018-43172040 GCTCACCGGCCCGTAGCCCCCGG - Exonic
1010368932 6:75085196-75085218 GCGCCCTGCCCCACGGACCCGGG - Exonic
1011742413 6:90375677-90375699 CCTCACTGACCCGGGACCCCTGG - Intergenic
1012476400 6:99618906-99618928 GCTCACAGCCTCGCGCTCCCTGG + Intergenic
1012476418 6:99618975-99618997 GCTCACAGCCTCGCGCTCCCTGG + Intergenic
1012476423 6:99618998-99619020 GCTCACAGCCTCGCGCTCCCTGG + Intergenic
1012912897 6:105137229-105137251 GCCCGCCGCCCCGCGCCCCCCGG + Intergenic
1016104679 6:140148150-140148172 GCGCCCTGCTCCGCGGCACCCGG - Intergenic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1017856838 6:158357069-158357091 GCCCACAGCCCCCAGGCCCCAGG + Intronic
1018102406 6:160452840-160452862 GCTCTCTGCTCCGTGTCCCCTGG + Intergenic
1018133379 6:160753615-160753637 GCTCTCTGCTCCGTGTCCCCTGG - Intergenic
1018612755 6:165661133-165661155 GCTCTCGGCCCCGCGCCCGCGGG + Intronic
1018892285 6:167990596-167990618 CCTCCCTGCCCCGCTGCGCCCGG + Intergenic
1019398595 7:837124-837146 GCCCACTGTCCTGCTGCCCCAGG - Intronic
1019411295 7:907938-907960 GCAGACGGCCCCGCGACCCCTGG - Intronic
1019432448 7:1005550-1005572 GCCCACTGCCCCGCTGCCGAGGG - Intronic
1019475726 7:1243135-1243157 GCTCCTGTCCCCGCGGCCCCCGG + Intergenic
1020784383 7:12556191-12556213 GCCCCCTGCTCCGCGGCGCCCGG - Intergenic
1021359360 7:19692280-19692302 ACCCCCTGCTCCGCGGCCCCTGG - Intergenic
1024300617 7:47884844-47884866 TTTCATTGCCCCGGGGCCCCAGG + Intronic
1025004167 7:55342517-55342539 GCTCACTGCCACGGGAGCCCGGG - Intergenic
1025250637 7:57349112-57349134 GCTCACTCCCACAAGGCCCCAGG - Intergenic
1029114528 7:98230539-98230561 CCTCTCTGCCCCCAGGCCCCGGG + Intronic
1029545390 7:101207724-101207746 GCTCAGTGCCCGCCGCCCCCAGG - Exonic
1031919045 7:127588306-127588328 GCTCTCGGCCCCGCCTCCCCCGG - Intronic
1031979034 7:128112542-128112564 GCCCACGGCCCCGGGACCCCTGG + Intergenic
1032339699 7:131059092-131059114 GCCCCCTGCTCCGCGGCACCCGG + Intergenic
1033662009 7:143408742-143408764 GCTCTGCGCCCCGCTGCCCCCGG - Exonic
1035316202 7:157998961-157998983 GCTCACAGTCCCCTGGCCCCCGG - Intronic
1035463848 7:159063167-159063189 GCCCCCTGCTCCGCGGCACCTGG - Intronic
1035567166 8:649506-649528 GCTCAGAGCCCCTGGGCCCCGGG + Intronic
1035649942 8:1256837-1256859 GCTGGCTGCCCCGTGTCCCCTGG + Intergenic
1035683522 8:1507187-1507209 GCCCCCTGCTCCGCGGCGCCCGG - Intronic
1036708067 8:11059717-11059739 GCTCCCCGGCCCGCGCCCCCCGG + Intronic
1037817269 8:22118838-22118860 GCTCCCTGCCCCACGCCCTCAGG - Intronic
1038534973 8:28347300-28347322 GCCCACTGCCCAGCTGCCTCGGG - Exonic
1040363153 8:46686548-46686570 GCTCTCTGCCTCTGGGCCCCAGG + Intergenic
1040471427 8:47738244-47738266 GCCCCTTCCCCCGCGGCCCCGGG - Exonic
1040495699 8:47963378-47963400 GCTCACTGCACCTCTGCCTCCGG - Intronic
1043873982 8:85464279-85464301 GCTCGCGGCTCCGCGGCGCCGGG + Intronic
1044901075 8:96945214-96945236 GCTCTCTGCCCCACTGACCCTGG - Intronic
1046661151 8:116949779-116949801 GCCCCCTGCTCCGCGGCGCCCGG - Intergenic
1046770508 8:118112200-118112222 GCCCCGTGCCGCGCGGCCCCGGG + Intergenic
1048072985 8:131040791-131040813 GCCCACTGCTCCGCGGCTGCAGG + Exonic
1049786929 8:144455549-144455571 TCTCACAGCCCCCCGCCCCCCGG + Intronic
1049787762 8:144459211-144459233 GCTCCCTGCTCTGCGGCCCGAGG - Intronic
1049801043 8:144517667-144517689 GCCCTCAGCCCCTCGGCCCCTGG + Intronic
1050380126 9:5020075-5020097 GCTCACTGCCCAGGGGCCTGTGG - Intronic
1053306189 9:36986262-36986284 GCTGATTGCCGCGCGGCCCGCGG - Intronic
1053545663 9:39020692-39020714 GCTCACTGCCTCCCGCCTCCCGG + Intergenic
1053749054 9:41235230-41235252 GATCCCAGCCTCGCGGCCCCCGG - Intergenic
1054254490 9:62800083-62800105 GATCCCAGCCTCGCGGCCCCCGG - Intergenic
1058727576 9:107818133-107818155 GCCCCCTGCTCCACGGCCCCTGG + Intergenic
1059452155 9:114377186-114377208 GCTCACTGTCCCACTGCTCCAGG + Exonic
1060200838 9:121651224-121651246 CCTCACTGCTCCGCAGGCCCTGG - Intronic
1060495139 9:124112948-124112970 GCTCACTACTCTGGGGCCCCTGG - Intergenic
1061157839 9:128875792-128875814 GGCCACTGGCCCTCGGCCCCTGG - Intronic
1061797355 9:133094552-133094574 GCTCACTGCCACTTGACCCCTGG - Intergenic
1061859535 9:133460761-133460783 GCTCACTGCCCCGCGGCCCCAGG - Intronic
1062008086 9:134251559-134251581 GCTCCCGGCCCCGGGGCCGCTGG + Intergenic
1062179576 9:135184060-135184082 GCTCACAGCCCCTCTGCCCTGGG - Intergenic
1062362157 9:136193274-136193296 GCAGACAGCCCCGCGGCCCAAGG + Intergenic
1062630292 9:137460265-137460287 CCTGACTTCCCCGGGGCCCCAGG - Exonic
1187294339 X:17984473-17984495 GCTAGCTGCCCCACGGACCCTGG - Intergenic
1187464469 X:19515211-19515233 GCTCGCCGCCCCGAGGGCCCCGG + Exonic
1196462133 X:115942496-115942518 GCTCATTGCCCTGAGGCTCCTGG + Intergenic
1196574884 X:117305628-117305650 ACTCACTGCCCCGGGGCCCAAGG + Intergenic